Human Origins 101: The Basics
The Fascinating Timeline of Humans
From 7 million years ago to 1500 BC in words and photos and pictures
by Godfrey Oswald
BSc Biochemistry (University of London), MSc Information Science (City University London)
"if a mutation creates advantage, it will thrive, driving evolution".... 2015 episode of Mutant Planet, Discovery TV
This fascinating science blog is currently 286 A4 pages long, so it is very extensive in detail and very much a textbook on human
evolution, and is updated from time to time as fresh new data is found. It will take time to read all of it in full, but I do have a detailed Table of
Contents list below, to enable browsing the entire ebook. At the end of this scientific ebook, are all the numerous sources I consulted,
and my favourite websites and Twitter feeds on human evolution. If you own an iPad, as I do,
I suggest that you use the Mac Safari web browser to make a perfect PDF and export (or email) this PDF to your iPad iBooks app
and read my HTML ebook on the go. You can do this each time this HTML ebook is updated and so delete the older PDF version.
N.B. Incidentally iOS 9 on the iPad/iPad Mini now actually allows you to save a webpage directly to iBooks as a PDF: just open this webpage on iPad Safari,
click on the small box pointing upwards, then choose "Save PDF to iBooks". The iPad Safari will then proceed to save this webpage as a PDF, and then it will
automatically export the PDF to your iPad iBooks app.
Expertise and Background Section A: Before the arrival of Human-like species
LET THE STORY COMMENCE..............
60 million years ago (during the Palaeocene epoch). Officially the oldest known primitive primate-like
mammal species (i.e. ancient Prosimians) finally appears in Africa, Europe, the Americas and
BBC Report on the shock discovery of the world's oldest
fossil of a 55million years old Eocene epoch primate, in China.
BBC Report on the discovery of Darwinus Masillae or Ida in Germany.
Ida was discovered in the 1980s in a fossil treasure-trove called Messel Pit, near Darmstadt in Germany.
25 million years ago, (during the Oligocene epoch) finally heralds the arrival of the ancestors of ancient apes and humans for the first time.
Primitive ancestors of ancient apes and humans
later gave rise to: humans (genus Homo); gorillas and chimpanzees (genus Gorilla
and Pan); gibbons / siamangs (Hylobates) and orang-utans (Pongo).
A major 2004
analysis of DNA from living apes and old world monkeys, using DNA molecular clocks, in Africa, Europe and
23 million years ago sees the arrival of Proconsul africanus (during the Miocene epoch). Once the divergence occurred 25 million years ago,
all modern humans and apes today
can trace
origins back to an early common ancestor called Proconsul africanus, discovered in
The oldest
fossils to evolve directly from Proconsul
appears to be Morotopithecus bishopi, discovered in Kamoyapithecus discovered in 1948 and dated to 18 million years ago.
From Primitive Apes to Primitive
Humans: the Missing Link One main
characteristic differentiating ancient apes from
ancient humans were the arboreal lifestyle of ancient apes, which spent a lot
of time in tress, perhaps looking for fruits, and allowing them to avoid
predators on the ground. Today if we look at the feet of other apes e.g.
gorillas and chimpanzees, we notice that their feet are like their hands, for
grasping tree branches and so allowing them to spend much time in trees as well
as on land, while humans have evolved feet suitable only for living on the
ground. According
to evolutionary biology, all ancient apes and humans are descended from a single common
ancestor (who evolved from Proconsul)
.
No scientific proof of this ancestor has been identified and so it is
eloquently known simply as the “missing link.”
WHY ARE HUMANS CLASSIFIED AS PRIMATES?
The
Homininae subfamily is made up of humans
(genus Homo); gorillas (genus
Gorilla) and chimpanzees (genus
Pan). All three are more related to each other than other apes such as gibbons / siamangs
(genus Hylobates) and orang-utans (genus Pongo), even though all five are part of the Hominoidea superfamily. For these reasons
gorillas and chimpanzees are known as members of the Great apes. The Great apes and humans are the most advanced of the
primates.
The Bonobos (or "Left Bank
Chimps"), also known as pygmy chimpanzees, were the last of the six advanced primate
species of the Hominoidea superfamily to be identified (in 1926), some three centuries after the other five
other members were known to science.
PRIMATE DIVERGENCE FINALLY BEGINS
That then
leaves an ancient primate lineage containing just the ancestors of humans, gorillas and chimpanzees. Clearly a common
ancestor of humans, gorillas and chimpanzees also existed, before all three diverged
into 3 separate genera. Humans thus are descended from a common ancestor of
humans, chimpanzees and gorillas, revisiting the “missing link” mystery. Pierolapithecus catalaunicus 13 million years ago appears
on the scene and might be a candidate for a common ancestor of humans, gorillas
and chimpanzees.
BBC Science Report: 'Original' Great Ape Discovered
Differences Between Humans and Chimpanzees at a Genetic Level
So when
did gorillas and chimpanzees evolve differently from humans?
Molecular
DNA evidence suggests that between 8 to 7 million years ago, first the gorillas, and then the
chimpanzees diverged from the ancestry leading to primitive humans.
This lead
to 3 distinct genera we find today: humans (genus Homo), gorillas (genus Gorilla)
and chimpanzees (genus Pan). Each
three genera then over 7 million years, evolved independently of each other.
To recap so far: there were major differences
between the DNA molecules of say chimpanzees (apes) and baboons (monkeys),
since the two species of primates have been evolving separately for 25 million
years. But the difference between humans and chimps was surprisingly small
because they have parted company just 6-7 million years ago.
Section B: Primitive Human-like
species arrive
7 to 6 million years ago in
The early
group of primitive human-like species that evolved later into primitive humans
are called hominids or hominins.
The differences between hominids/hominins and gorillas and chimpanzees can be seen in
the contexts that apes are distinguished from monkeys mostly by their lack of
tails, bigger sizes and stronger arms and shoulders, while hominids are distinguished
from gorillas and chimpanzees, mostly by their more upright postures, the shape of the feet which evolved over
time to be less adapted for grasping like the hands, and bigger brain sizes.
But most important characteristic was that hominids took the first steps
towards walking upright. In the final analysis upright posture and bipedal gait are characteristic of hominids.
The
Smithsonian Institution in the
http://humanorigins.si.edu/evidence/human-family-tree
Sahelanthropus tchadensis, which dates from 6.9 million years ago. It was
nicknamed Toumai, and was discovered
in 2001 by a research team led by French anthropologist, Professor Michel Brunet in
The reason
why some biologists believe Toumai belongs to the lineage where humans diverged
from chimpanzees is because Toumai shared chimpanzee characteristics, but its
skull indicated it walked upright due to erect spine structure attachment
socket on the skull. Other anthropologists theorise that Toumai represent the last
common ancestor between chimpanzees and primitive humans before divergence.
Orrorin tugenensis dates from 6 million years ago, and
was discovered in December 2000 in the Tugen Hills of
Ardipithecus kadabba dates from 5.1 million years ago. It is the third earliest
hominid fossils discovered. Its skull likewise indicated it walked upright. It was discovered
at the Middle Awash Valley, Ethiopia.
Ardi (Ardipithecus ramidus)
announced in October 2nd 2009, but first discovered in 1994 in
Little Foot dates from 3.9 million years ago. It was discovered in
1994 by South African paleoanthropologist Professor Ronald J Clarke (University of Witwatersrand) in
Of all the
early Australopithecines discovered so far to date, the oldest and undoubtedly
the most famous species was the celebrated Australopithecine nicknamed Lucy (Australopithecus afarensis).
Lucy was
discovered in
However
there was a shock discovery that concluded in 2001 that Orrorin tugenensis (mentioned above), is in fact
actually an Australopithecine and not a member of the Ardipithecines. Since
it dates back to about 5.8 million years ago, it is double the age of Lucy.
In 2008,
an article in the journal Science (21
March 2008, 1599-1601), titled Orrorin tugenensis Femoral Morphology and the Evolution of Hominin Bipedalism the authors agreed that the
5.8 million-year-old Orrorin tugenensis
was indeed an early type of primitive Australopithecine, because it exhibited long periods of bipedalism. Lucy however remains a major legacy in
timeline of human evolution, as it was a near complete skeleton find compared to the few recovered fragments of Orrorin tugenensis .
Eight other (Middle Pliocene epoch)
species of Australopithecines related to Lucy worth mentioning are described now below in detail.
Several of them co-existed alongside Lucy, BUT only Lucy and Australopithecus sediba (discussed below).
are the direct ancestors of
Homo habilis, our earliest homo species to evolve from the Australopithecines.
(Australopithecus prometheus) (3.9 million years ago)
Also known as Little Foot, it dates from 3.9 million years ago. It was discovered in 1994 by South African paleoanthropologist Professor Ronald J Clarke (University of Witwatersrand) in Sterkfontein, South Africa. It is the oldest hominid fossil found outside East Africa, where the vast majority of early hominids evolved from.
South African Journal of Science news about Little Foot, Nov/Dec 2008. The reason why it is so old was because,
it was originally classified as an ardipithecine.
(Australopithecus deyiremeda) (3.1 million years ago)
was discovered by a team led by Dr Yohannes Haile-Selassie, a American-Ethiopian paleontologist in 2015
in the Afar region of Ethiopia, not far from where Lucy was discovered way back in 1974. It is the
most recent Australopithecine discovered. Like most Australopithecines, it was mostly a plant-eater or herbivore, feeding on nuts, fruits and wild
grasses.
(Australopithecus bahrelghazali) (3.1 million years ago)
was discovered by Professor Michel Brunet, a French paleontologist in 1995 in the ancient riverbed of Bahr el Ghazal in Chad.
The first Australopithecine to be discovered outside of southern and eastern Africa.
Professor Brunet would later
discover the 6.9 million year old Ardipithecine named hominid Toumai in 2001, also in Chad (the oldest hominid ever discovered).
Kenyanthropus platyops / Australopithecus
platyops (3
million years ago) discovered in 1999 in
Taung Child (Australopithecus africanus) (2.5 million years ago) was
discovered in 1925
Australopithecus
garhi (2.3
million years ago)
It was discovered in 1996 at the Middle Awash region of Ethiopia by Ethiopian paleontologist Berhane Asfaw and American paleontologist Tim White.
Tim White went on to discover the Herto Man fossils (discussed later under archaic Homo sapiens).
Australopithecus rudolfensis / Homo
rudolfensis (2.2
million years ago) despite the use of term Homo, because it was more
related to the later Homo habilis, due to its big brain case, which was the largest of all the Australopithecines, the fossil
was indeed an Australopithecine. It was once thought by many to be a member of the species
Homo habilis but the differences compared to other Homo habilis skulls were considered just too great.
It was discovered by Bernard Ngeneo, Richard Leakey and
Meave Leakey in 1972, at Koobi Fora on the east side of Lake Turkana
in Kenya. Fossils were also found in Urhara, Malawi.
2011 scientific report on the relationship of Australopithecus sediba to Homo habilis
Way back
in 1959 at the Olduvai Gorge in Tanzania,
long before Lucy’s discovery in
1974, Mary and Louis Leakey, the most famous anthropologist couple the world
has seen, came across a species of hominids that anthropologists today call
robust australopithecines. The Olduvai Gorge is a great natural gash in the Serengeti Plain, where hundreds of feet of ancient lakebeds have been exposed by earthquake action.
The fossils that Mary and Louis Leakey discovered were radio carbon dated from 2.6
to 2.5 million years ago and only lived in Homo habilis Arrives
Homo habilis, who only lived in Homo erectus / Homo ergaster Arrives on the Scene Richard Leakey’s 1984 discovery of a
complete skeleton specimen of Homo
erectus was one of the earliest and best preserved and was named Nariokotome Boy,
Homo erectus is
believed to be the first to use fire
and develop more advanced stone hand tools (Acheulean tools) such as stone flints. But some biologists are skeptical that Homo erectus used fire due to lack of
fossil evidence, and postulate the use and control of fire occurred in later
species of Homo 700,000 to 200,000
years ago. However as noted before Homo
erectus was the first hominid
species to leave Because
they walked on two feet all the time and walked completely upright, Homo erectus was able to walk for long distances
on land before needing to sit down. Because of this ability to walk long
distances, Homo erectus was able to
leave Homo erectus
went out of Africa about just before 1.8
million years ago to populate October 2013 scientific report on the re-evaluation of the Dmanisi fossils and human evolution
The three major Homo erectus specimens have been discovered in the Middle East and eastern Asia.
1 million years ago, the world
population was estimated to be about a few thousand Homo erectus primitive humans living in Africa and Homo heidelbergensis Arrives
980,000
to 800,000 years ago, Homo erectus and Homo ergaster in Africa next evolved into Homo
heidelbergensis, who lived in
Several groups of Homo heidelbergensis manage to leave
Africa for a second time for the Middle East, (the last sort of this type
migration out of Several more Homo heidelbergensis fossil records around the world, now provide definitive
proof that the art of producing and
controlling fire had been fully mastered by Homo heidelbergensis. Cooked meat and other animal flesh all over
the world were soon preferred over raw meat.
Before 200,000 years ago.
Locations of primitive human fossils
worldwide before 200,000 years ago (Homo
habilis, Homo erectus, Homo
heidelbergensis, Homo neanderthalis, Homo floresiensis and the Denisovans
)
Locations of archaic Homo sapiens fossils or early anatomically modern humans Worldwide 195,000 years ago to 40,000 BC
2011 Discovery report on when humans began wearing clothes 2011 Molecular Biology and Evolution journal report on when humans began wearing clothes.
Oldest archaic Homo sapiens Revealed
Prior to
2005, as mentioned before, the oldest archaic Homo sapiens fossil was dated from 160,000 years ago (Homo sapiens idaltu), and was discovered
in northern Ethiopia in 1997 by U.S. anthropologist Dr Tim White (University of California, Berkeley) at Herto Bouri in
the Middle Awash site of Ethiopia's Afar Triangle. It was nicknamed
BBC Report on Herto Man Fossils
COUNTDOWN TO THE OLDEST ANATOMICALLY MODERN HUMANS WORLDWIDE
5): Laetoli 18 or Laetoli Hominid 18 or just simply LH 18 was the 4th oldest
archaic Homo sapiens dug up. It was discovered in 1976 by Dr Mary Leakey's
team in Laetoli in Locations of archaic Homo sapiens fossils or early anatomically modern humans Worldwide 195,000 years ago to 40,000 BC
Around 90,000 years ago, Homo sapiens or Just Homo sapiens finally evolved.
Better known as Later Anatomically Modern Humans, they were more advanced than previous archaic Homo sapiens
we had earlier discussed above. Thus by 75,000 years ago, or during the Upper Paleolithic era, Later Anatomically Modern Humans are living only in Africa,
getting ready for one final but monumental migration out of Africa.
Why Wasn't Archaic Homo sapiens A Successful Migration?
There
will be one more major departure of Homo sapiens from
70,000 to 51,000 years ago Homo
sapiens sapiens first arrived in Asia, via the
Before examining the Post-Toba migration in detail, here are
4 different world maps from different sources below, showing how Homo
sapiens sapiens left
The above genetic map on human
evolution and migration was produced from the research work of five leading pioneers of tracing human history through genetic mutations using either MtDNA or Y-Chromosome DNA:
According
to the American Journal of Human Genetics
(June 2003) the grounds for the fact that the population of modern human
species was at one time drastically reduced comes from the fact that all humans
have virtually identical DNA, i.e. humans are genetically highly homogenous
(this compares with other mammals like and bears which show far greater genetic diversity).
In fact, much greater genetic diversity exists between nearby populations of chimpanzees than humans in different continents.
Massive
climatic calamities such as the Toba
eruption were what caused the human gene pool to be reduced to a small size. The Toba eruption circa 74,000 years ago was a huge category 8 super volcano catastrophe that
happened in central
The second
successful wave of just 10,000 modern Homo sapiens sapiens left
SECTION E:
SUMMARY
MtDNA MARKERS IN HUMANS: INTRODUCTION TO MITOCHONDRIAL EVE
DETAILED LOOK THE MAJOR MtDNA HAPLOGROUPS IN AFRICANS, ASIANS AND EUROPEANS
A lot of research has been carried out to study the L3 migration out of Africa. In the Jorurnal
Molecular Biology & Evolution, Professor Pedro Soares and over eleven researchers from around the world (Porto, Prague, Dubai, Glasgow and Cambridge)
published the result of one such major study on the L3 migration.
A link to the journal article is given below:
The Expansion of MtDNA Haplogroup L3 within and out of Africa
Professor Pedro Soares et al. Molecular Biology & Evolution, 10:1093, 2011.
In the above article, the Professor Pedro Soares and his team concluded that there were indeed two major migrations out of Africa, but the second one was the most important.
Recall in Section C, I discussed the two major migrations out of Africa:
The Northern Route migrations (120,000 years ago ) and the Southern Route migrations (70,000 years ago)
Meet the Lzzards, 2-hour BBC TV documentary about human evolution
Professor Sykes proposed the following:
Genebase scientific paper on the MtDNA genetic markers For the non-biochemist!
Diagram above shows how the original African L3 genetic MtDNA marker from Mitochondrial Eve mutated over several thousands of years first into the N and M MtDNA genetic markers then into several new MtDNA genetic markers found exclusively outside Africa. These markers help us know when and where different ethnic groups of humans we see in the world today emerged, from Los Angeles, Europe and Africa to Tokyo.
However Mitochondrial Eve, circa 200,000 years ago is the original carrier of the L haplogroup. Recall that the
L haplogroup is oldest possible MtDNA genetic marker found in humans from any ethnic group, and it dates back to 190,000 to 200,000 years ago.
Andrew Marr in the first episode of the exciting BBC
TV’s documentary series The History of the World (September 2012), also explains that DNA
mutation studies in genetics labs showed that just one or two particular groups of Homo
sapiens sapiens who left Africa 70,000 years ago populated the
rest of the world outside Africa, over thousands of years. This compares with the fact that several
hundred different groups of primitive humans from Homo erectus to Homo heidelbergensis
had left
The Y-Chromosome DNA marker genetic map (Map 1) is rather a less complex representation of human Y-Chromosome DNA markers worldwide or worldwide genetic markers.
A second and third detailed Y-Chromosome DNA marker genetic maps are shown later on below.
The above Y-Chromosome DNA marker genetic map mostly shows DEFINING MUTATIONS, so it uses the
letter M through out. M may also stand for Marker. A defining mutation is where we find the presence of the single nucleotide polymorphism or SNP marker on
Y-Chromosome DNA. E.G. In the above map, Haplogroup R1b is identified by the presence of the single-nucleotide polymorphism (SNP) mutation M343. If you look at the where Europe is located above, you can see the migration route of the M343 marker. The R1b haplogroup is discussed later on.
N.B. The above map does not show all
possible defining mutations, because the most complete Y-Chromosome DNA genetic maps in 2016 show
over 150 possible Y-Chromosome DNA defining mutations spread over the 20 major Y-Chromosome DNA haplogroups
or Clades viz A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S and T. Both the S and T haplogroups are
recent additions. Haplogroups S and T were formerly part of haplogroup K.
SECTION F: MODERN HUMANS ARRIVE EUROPE 45,000 YEARS AGO
BBC Science Report on the Kostenki fossils
Meanwhile
the oldest rich sources of fossils of Homo
sapiens found in Europe were the Romanian
fossils discovered in 2002 and 2003 in the south-western BBC Science Report on Pestera
cu Oase fossils
Bryan
Sykes, The Seven Daughters of Eve,
provides a fascinating account of how the descendants of Mitochondrial Eve reached BBC Science Report on the Seven Daughters of Eve
Homo sapiens sapiens
arrival in
Europe and the Near East encountered surviving Cro-Magnon man people (famous for the Chauvet Cro-Magnon
caveman paintings in
The Cro-Magnons
had already spread out all over Europe, hunting, foraging, constantly adapting
to changing conditions for tens of thousands of years. In the exciting book Cro-Magnon:
How the Ice Age Gave Birth to the First Modern by Brian Fagan, we learn that
85% of Europeans are direct descendants of Cro-Magnons.
About 45,000 years ago when the Cro-Magnons or archaic Homo sapiens reach Europe, some come across the
existing Neanderthals and Homo
heidelbergensis species in Eurasia and competition for food and mating
rights begins as was in Africa before. At this time
the climate is getting warmer (which Neanderthals are not quite adapted
too, since if we remember they had evolved when the climate was very much
colder). Climatic fluctuations (which the
Neanderthals cannot adapt to) together with competition from Cro-Magnons or European archaic
Homo sapiens
means Neanderthals population begins to
dwindle. Scientists are not totally sure what else transpired when Anatomically Modern Humans arrived
According
to Dr Brian Fagan in his book (Cro-Magnon: How the Ice
Age Gave Birth to the First Modern Humans )
the prolonged encounter between the Cro-Magnons and the Neanderthals and
between 45,000 and 39,000 years ago was a rather brutal period of uneven
fierce competition between two different early species of humans, and the Neanderthals lost and would later become extinct just after 39,000
years ago. This means that Neanderthals lived alongside Cro-Magnons for at least 5,000 years that is between 45,000 to 39,000 years ago.
However it should be pointed out that the Neanderthals survived
between 350,000 to at least
40,000 years ago, much much longer than the Cro-Magnons or other any modern humans have been around today.
Cro-Magnons are the earliest known form of anatomically modern humans found in Europe, dating from about 50,000 to 30,000 years ago.
One remarkable thing about the Neanderthals was that they were were very good experts in living in extremely cold weather: they survived the longest spells of very cold weather
(glaciations of the Last Ice Age from 750,000 years ago) ever endured by any early homo species.
Scientists say that the very last Ice Age began 4 million years ago. Before then at least five major Ice Ages
have occurred throughout Earth's history, the earliest was over 2 billion years ago.
During each Ice Age, several glaciations occurred and disappeared over thousands of years.
The last glaciations of the last Ice Age began about 750,000 years ago and ended permanently about 12,000 years ago.
this makes the Neanderthals the first early homo species to survive an Ice Age glaciation!
While the Neanderthals had the characteristic huge brow ridges or supraorbital ridge above the eyes as found in all early homo species discussed earlier on, they had one new characteristic: They had several cold weather adaptations such as having a short stocky build, a large nose to warm cold air before it reached the lungs and had much more hair on the body compared to humans today.
The answer to the Neanderthals' demise lies part to
several factors such as hunger and malnutrition competing for food with archaic
Homo sapiens and
the peculiar discovery about Neanderthal female DNA. The absence of any
significant amount of female Neanderthal mitochondrial DNA and presence
of a higher Neanderthal Y-chromosome in modern humans in Europe and
SECTION G: MODERN HUMAN ARRIVE MIDDLE EAST and ASIA FROM 65,000 YEARS AGO
Here is a
curious fact:
An
undisputed fact is that aboriginals are still hunter-gatherers to this day
practicing no form of agriculture (in the rural areas they are mostly hunter-gatherers
but in urban areas they have adopted urban lifestyles).
Africa
itself has its own surviving aboriginals, Mitochondrial DNA of the Khoi
and San aboriginals
(formerly known as Hottentots), living in the Kalahari Desert portions of
Namibia, Botswana and South Africa appeared to have diverged 90,000 and 180,000
years ago from main stock of archaic Homo sapiens living in most parts of Africa who were being displaced
by Homo sapiens sapiens from East Africa (i.e. the massive Bantu migrations from central and east Africa into south Africa). The
analysis of the DNA of the Khoi and San people also
suggest they are not only different genetically but are much older than the rest of
Africa in terms of ancestry, proving they had existed long before Homo sapiens sapiens
arrived to the southern parts of Africa from East
Africa. When modern Homo sapiens sapiens arrived they competed
for food and eventually displaced the Khoi and San
aboriginals, who had earlier lived in much of southern
A
famous enjoyable film was made about the Khoi and San
people in the 1980s called The Gods Must
be Crazy.
SECTION H: MODERN HUMAN ARRIVE THE AMERICAS 28,000 YEARS AGO
------------------------------------------------------------------------------------------------- Information on the Ancient Human Occupation of Britain (AHOB) study
Glacial
sheets from the last great Ice Age
from the North Pole reached most of north central parts of Europe, Asia and the
12,000 BC, solid ice sheets from the last great Ice Age melted
and had disappeared, save places like northern Alaska, northern Canada, northern Russia, northern Scandinavia, northern Greenland, (these area are all practically at or above Latitude 66 degree North i.e. the Arctic Circle) as well as Antarctica in the south pole, were miles of solid thick ice sheets still remain. Most of mankind are still hunter-gatherers.
11,000 BC, with the Ice Age period in
SECTION J: AGRICULTURE AND THE ARRIVAL OF CIVILIZATIONS
About
9,000 BC, in places
like
About
9,000 - 6,000 BC, sheep
and goats and other cattle are finally domesticated by humans in the Middle and Near East.
Several fruits such as apples, oranges and plums etc are domesticated from wild versions in this period as well. Humans begin to learn to use
metals, but only on a very small scale compared to the later bronze age. The metal most widely used was copper, as copper smelting relics dating 7,000 BC have been discovered in ancient Anatolia (modern day Turkey).
Pottery develops more rapidly in many parts of the world. Around
6000 BC, pigs are domesticated in
About
8,000 BC The world population
(from Gordon Kerr's book Timeline of World History ) is estimated as
5 million. Half of these live in the fertile crescent and China. 12,000 years ago
the world population was roughly 6 million (page 84,
The 10,000 Year Explosion: How Civilization Accelerated Human Evolution
by Gregory Cochran and Henry Harpending). From these two sources and others as well, we have a pretty good idea how many people were living in the world around the time agriculture had just been invented and people no longer had to have nomadic lifestyle of hunter-gatherers between 12,000 and 10,000 years ago.
About
5,000 BC, a settlement
grows at fertile river
About
4,000 BC, Yang-shao rice farming culture in
About 3,200 BC. Start of the first cities, in places,
such as
SECTION K: THE BRONZE AGE BEGINS
Just after 1800 BC
2,000 BC the concept of Zero is invented. According to several texts tracing the history of mathematics such as Professor Marcus du Sautoy's 2008 BBC TV documentary (see sources) and A Curious History of Mathematics by Joel Levy, published in 2013, in ancient times before the ancient Greeks,
five nations had the world's best mathematicians: Babylonia, ancient India, ancient Egypt, ancient Persia (Iran), and ancient China. In Babylonia (ancient Iraq),
Babylonian mathematicians beat
Chinese, Indian and ancient Egyptian mathematicians in creating the concept of Zero and place value (even though they used a number system based
on 60 not 10 like we do). The Persian civilization did not exist around 2,000 BC, an earlier civilisation based in Iran known as Elam existed.
The concept of Zero made it quite easy to do simple calculations like adding large numbers and allowing one to reperesnt numbers like 10, 100
and 1000. Meanwhile place value helps us distinguish 1s, 10s, 100s, 1000s from each other. However,
while the Babylonians used a simple mark to
show the position of Zero, it was Chinese mathematicians (around AD 300) who later invented the famous oval shape for zero i.e. "0" that we all use today! The invention of Zero was
exploited by the ancient Greeks, hundreds of years later, who became the leading nation of expert mathematicians (ancient Greek mathematics theories e.g. Euclid, Archimedes,
Pythagoras etc, are still taught today at universities worldwide).
1800 BC.
The alphabet is first invented in two places: by the Canaanites (in modern day Palestine), their alphabet was
known as the Proto-Sinatic script, some scholars call it the Proto-Cannanite script.
Two major ancient Proto-Cannanite scripts were invented and named after the exact place the ancient samples of inscriptions were discovered:
The Serabit el-Kadem inscriptions and the The Wadi el-Hol inscriptions.
The other earlier
alphabet worth mentioning was invented outside Canaan and Egypt occurred in what is today modern day Syria, the (Ugaritic script) due to discovery of the famous Ras Shamra inscriptions.
Centuries after Joshua had led the Israelites
into Palestine then called Canaan (the Canaanites were the original inhabitants of Palestine at the time the Israelites, led by Joshua arrived there),
Jewish scribes come across the Proto-Sinatic scripts used in Palestine and modify and
adopt it to form the Old Hebrew script. Ancient Israel thus becomes the 3rd nation to adopt an
alphabetic writing system after ancient Palestine and Syria.
These two early alphabets are improved by Phoenician scribes (from nearby modern day Lebanon), circa 1,400 BC returning from Palestine,
who made modifications (used less pictures for alphabet letters)
on the
Proto-Sinatic script and came up with the much improved
Phoenician script which the whole world still uses today: the ancient Aramaic script, as well as
the Arabic, Modern Hebrew, Brahmi (India, Bangladesh, Thailand, Laos, Cambodia etc), Cyrillic (Eastern Europe), Greek,
and Latin (Roman) scripts used all over Europe, Africa, parts of Asia, and the Americas etc, all descend from the Phoenician script.
1500 BC
SECTION L: THE IRON AGE BEGINS
Are
humans still evolving? Well maybe at a slow pace now as it takes a few
thousands of years for evolution to show its true colours. Physically, we are much more
taller, more cleverer, better immune to many diseases and much more
healtheir than our counterparts 1000 years ago, when Pope Urban II declared the
First Crusade. 1000 years from now future humans will be much more advanced
than they are today.
However
human are still evolving in the sense we are mastering ourselves and Mother
Nature much better and better as time goes by.
Just look at the sequence of events in the last 300 years: Humans
discovered tiny bacteria for first time in late 17th century, (but
why did it take that long?), Electricity that has been with us since time
immemorial was only harnessed in the 19th century, before then the
ancient Greeks and the Renaissance saw the mystery of electricity as
unexplained but out there. Developing
the periodic table of elements in the 19th century eventually
allowed mankind to discover the existence of several new elements and select
the right specific elements from the periodic table and split the atoms to use nuclear
energy the following century. DNA research, space travel, silicon chips, computers, and
the jet age also arrived in the 20th century.
Humans might not be able to run as fast as Cheetahs;
smell tasty food over a mile away as Grizzly and Polar Bears can; have night-vision
capability like Owls or Bats;
be vicious apex predators as Great White Sharks or "Salty" Crocodiles are;
keep standing for hours while sleeping as Giraffes can; fly as fast as Swift birds;
or hold our breathe while under water for over 30 minutes like Whales can etc. We can of course
use our intelligence (due to evolution selecting us for smart brains) to enable us to build tools or devices, and make us do all these incredible things other animals can: make us fly fast (planes), travel fast on land (cars), swim under water for over an hour (diving gear), or be 10,000 times more vicious (nuclear bombs) etc.
Godfrey
Oswald, MSc, BSc. First loaded on the web: Summer 2012. ---------------------------------------------------------------------------------------
ALL THE SOURCES USED FOR THIS EBOOK AS WELL AS FURTHER READING
This ebook has explained in great detail, how in 1987 the revolutionary use of MtDNA (Mitochondrial DNA) was used
to discover the genetic proof of
Out of Africa theory at the prestigious University of California, Berkeley by Professor Allan Wilson and his PhD students Dr Rebecca Cann and Dr Mark Stoneking. Their ground-breaking research work titled Mitochondrial DNA and Human Evolution was published in Nature journal in 1987, for more details of this research work see "Sources" below.
Their research several molecular biology procedures such as one called DNA Molecular Clocks, based on looking at gene mutations rates.
By knowing how often genes change, and then counting up the number of genetic differences between different
species or groups of people, scientists can create a "molecular clock" to decipher how long ago they shared a
common ancestor. Professor Wilson and his team concluded that all humans today can trace their origins back 200,000 years to Mitochondrial Eve.
The
sources I sought and found were numerous, books, journals (e.g. the American Journal of Human Genetics and Current Anthropology among others), newspapers, magazines,
TV programmes, websites such as the informative BBC Science reports whose links are used throughout this ebook, and
DVD documentaries.
Main Sources: Mostly Books on Palaeoanthropology and Molecular Genetics Alice Roberts, The Incredible Human
Journey, 2010. BBC DVD and paperback from
Bloomsbury Publishing. My favourite source also comes as a paperback version of the
documentary DVD. Dr Roberts uses non-technical terms to describe how mankind
left Alice Roberts, Origins
of US, 2011, BBC DVD. Alice Roberts, Evolution:
The Human Story, Dorling Kindersley, 2011. Russell L.
Ciochon and John G. Fleagle, Human Evolution Source Book, 2005. Bryan Sykes, The Seven
Daughters of Eve, Corgi, 2001. Brian
Fagan Cro-Magnon: How the Ice Age Gave
Birth to the First Modern Humans
Bloomsbury Press, 2011.
Jared Diamond, Guns, Germs and Steel, Vintage Books, 1999. This book provided the best source for
factual data on how humans went from being hunter-gatherers to farmers.
Juan Luis Arsuaga and Ignacio Martínez, The Luigi Luca Cavalli-Sforza, Genes, Peoples and Languages, Penguin, 2001. Dawkins, Richard, The Ancestor's Tale, Houghton Mifflin, 2004. Camilo J. Cela-Conde and Francisco J.
Ayala, Human Evolution: Trails from the Past,
Oxford University Press, 2007. The American
Journal of Human Genetics, vol 84, p 740. The Search for Adam
and Eve: Scientists Explore a Controversial Theory About Man's Origins",
January 1988 Newsweek Magazine (based
on the Cann et al study). Stephen Oppenheimer, Out
of Chris B. Stringer, The Origin of Our
Species. Chris B.Stringer and Robin MiKie African Exodus: The Origins of Modern
Humanity, Chris B. Stringer , The Complete World of Human Evolution,
Thames & Hudson, 2011. Clive Finlayson, The Humans Who Went Extinct: Why Neanderthals died out and we survived. Michael Cook, A Brief History of the Human Race. Granta Books, 2003. Spencer Wells, The Journey of Man: A
Genetic Odyssey, Penguin, 2003. Main Sources: Mostly Periodicals on Molecular Genetics
Adcock G.J., Dennis E.S., Easteal S., Huttley G.A., Jermiin L.S., Peacock W.J. et al. (2001):
Mitochondrial DNA sequences in ancient Australians: implications for modern human origins.
Proceedings of the National Academy of Sciences, USA, 98:537-42.
Cann,
Rebecca L., Mark Stoneking, and Allan C. Wilson (1987),
“Mitochondrial DNA and Human Evolution,” Nature, 325:31-36, January 1.
Cooper, A., Rambaut, A., Macaulay, V., Willerslev, E., Hansen, A. & Stringer, C.B. (2001), Human Origins and Ancient Human DNA. Science, 292: 1655-6
Höss M. (2000), Neanderthal Population Genetics. Nature, 404:453-4.
Lewin, Roger (1987), “The Unmasking of Mitochondrial Eve,”
Science, 238:24-26, October 2. Morris, Andrew A. M., and Robert N. Lightowlers
(2000), “Can Paternal mtDNA be Inherited?,” The
Lancet, 355:1290-1291, April 15.
Ovchinnikov I.V., Götherström A., Romanova G.P., Kharitonov V.M., Liden K., and Goodwin W. (2000), Molecular Analysis of Neanderthal DNA from the Northern Caucasus. Nature, 404:490-3.
Rodriguez-Trelles
Francisco, Rosa Tarrio, and Francisco J. Ayala (2002), “A
Methodological Bias Toward Overestimation of Molecular
Evolutionary Time Scales,” Proceedings of the Schwartz, Marianne and John Vissing
(2002), “Paternal Inheritance of Mitochondrial DNA,” Stringer, C.B. and P. Andrews (1988), “Genetic and Fossil
Evidence for the Origin of Modern Humans,” Science, 239:1263-1268, March 11. Tierney, John, Lynda Wright, and Karen Springen
(1988), “The Search for Adam and Eve,” Newsweek, pp. 46-52, January 11. Williams, R. Sanders (2002), “Another Surprise from the
Mitochondrial Genome,”
HTML e-textbook was last modified, revised with either updated or
fresh data, brand new photos, brand new pictures: 26th December 2018.
If you have an earlier version of this eBook as a PDF, delete that for this one.
The human journey began with the
Ardipithecine and Australopithecine hominids 7 million years ago. By the time you have finished enjoying this exciting eBook, you can look at the picture above
and easily figure out how, when and why these many human ancestors evolved and what characteristics they all had that were ultimately
passed onto modern humans: us!
If you have already finished reading this entire extraordinary e-textbook and science blog and are eager to keep up to date with the latest discoveries in human evolution and evolutionary genetics,
use your web browser FIND or SEARCH button and look for
the keywords BREAKING NEWS or NEW UPDATED DATA. In these sub-headings I either add brand new data I have just come across OR I summarise new important
scientific discoveries about human origins, that have recently come to light in the last 5 years and also list the sources.
Although I am neither an anthropologist nor geneticist, I am a scientist by university training, and the various biological subjects
(biology, biochemistry, cell biology, cellular genetics, molecular genetics etc) of my first degree, BSc in Biochemistry (University of London King's College),
my decade long professional writing skills, and my library and information science (LIS) background of my MSc masters degree (City University, London)
has allowed me to pursue
my hobby in reading and writing extensively about human evolution. Before embarking as a professional writer, my career began as a librarian in scientific, academic and medical libraries.
Rather than writing yet another book on human evolution, (my main professional writing focus at the moment are completing several ghostwriting projects,
finishing my brand new spy novel and promoting my newly published 2017 (3rd edition) of my massive (401 pages) reference book,
Library World Records ,
available on Amazon.com since 2004 (and an Amazon Top 5000 Bestseller in 2004/2005).
I decided on a scientific HTML eBook, which can be easily updated as fresh new information comes to light. In a nutshell: I am a former science
librarian, a published writer, and blogger with a very strong interest in researching human origins via paleoanthropology and molecular genetics.
Introduction
This timeline of human evolution for the curious or non-geneticist (first compiled on the web during the multicultural London 2012 Olympics event)
came from the various bits of data here and there, I have been collecting for almost 10 years,
while working at the United Nations WHO Library in Geneva, Switzerland back in the summer months of 2003.
In the old magazines section of the medical library one day during my lunch break,
I came across an old January 1988 issue of Newsweek magazine. It was about someone called Mitochondrial Eve.
I was curious about name and meaning. Also in 2003, mainstream media worldwide had been reporting on the completion of the
very expensive $2.7 billion Human Genome Project in April 2003, and exciting brand new facts about our DNA
were being revealed for the very first time.
From then on my interest in human evolution was suddenly super piqued and still remains piqued to this day.
This scientific HTML eBook, for those curious and non-geneticist about human evolution, is thus
a well-researched treasure trove of facts, data and other information, and relies
exclusively on the research work carried out by scientists over the decades from the Victorian times of Charles Darwin to modern day.
The sensational 1987 Mitochondrial Eve DNA research project carried out by
Professor Allan Wilson and his PhD students Dr Rebecca Cann and Dr Mark Stoneking,
at the University of California, Berkeley is discussed in
great detail later on in this HTML eBook at the genetics tutorial part, see Section E.
Sources
Over 300 different sources were sought and found when I began to compile data from 2003, including
numerous books, science journals (using PubMed Medline database and Google Scholar database), newspapers, magazines, TV programmes, websites such as the informative BBC Science reports whose
links are used throughout this HTML eBook, and DVD documentaries. OCLC's WorldCat database allowed me to search for which libraries all over Britain had
the books I needed to
consult for this eBook. Aside from my main research work since 2004 at the British Library (a second home to me),
for several books I had to travel to public and university libraries in London, Manchester, Oxford, Cambridge, Liverpool, Milton Keynes
(Open University library), Mitchell Library in Glasgow and the Library of Birmingham. Bibliographic details of all the
sources used in this eBook are listed near the end of this eBook.
Typical Questions
This scientific HTML eBook about human origins answers some of the evolution questions people, students, kids and
teenagers ask each other all the time:
1. When and why did our human ancestors walk on two feet instead of all fours?
2. When did our human ancestors first populate Asia, Europe and the Americas, after leaving Africa?
3. When did our human ancestors begin to wear clothes? when did ancient humans
lose all their thick fur-like hair on their bodies except on the head?
4. When did our human ancestors begin to use fire to cook raw meat, fish etc?
5. Since chimpanzees share a common ancestor with humans 7 million years ago, how come humans can speak different languages and
chimpanzees can't?
6. When and why did our human ancestors evolve different skin colours? When and why did different ethnic groups in ancient
humans occur after they left Africa 70,000 years ago?
7. Why was the total world population of our ancient human ancestors just 13,000 people about
70,000 years ago? What is the name of the event that almost wiped out all our human ancestors 74,000 years ago?
8. What is the name of the African woman, 200,000 years ago from whom all of us descend from?
9. Somewhere in Africa today are the oldest human cultures and descendants of the oldest ancestry in humans today, who are they?
10. Who were the first people to arrive in pre-historic India, Malaysia, Indonesia, The Philippines and Australia after leaving Africa 70,000 years ago?
11. From whom do Native Americans in Canada and the U.S. originally descend from 20,000 years ago?
12. What types of DNA test does an American, a Brazilian or a Canadian need to take to trace their ancestors before 1492?
13. How do scientists extract DNA from our cells and test it for genealogical studies?
14. What are the three most common genetic marker groups or haplogroups found in Africans, Europeans and Asians?
15. What actually caused some species of ancient pre-historic humans to go extinct,
leading to just one human species today, us?
If you find yourself one day searching Google for answers to these questions, then this website provides all your answers.
Come and join me on a remarkable and exciting 7 million year journey to trace
the origins of modern humans today from Purgatorius ceretops to Homo sapiens ....and you do not need a passport or a visa!!
My style of
writing for this eBook is similar to Dr Isaac Asimov and Dr Carl Sagan: the use of popular science. Isaac Asimov and Carl Sagan were famous scientists
who spent a great deal of their scientific careers writing enjoyable books
explaining science in such a way that teens and adults all enjoyed their books. Other popular science writers include
Professor Jared Diamond who wrote the enjoyable book about ancient human history (Guns, Germs and Steel), Professor Stephen Hawking books on
astronomy such as the fascinating
(A Brief History of Time) and the many books written by
Sir David Attenborough on natural science. They all interpret past and present data on their chosen subject for a general audience. Sometimes university lecturers
teach with some comic relief that invokes laughter from students. The lecturers are simply using the notion of popular science
to get a very difficult point across to students, in particular 1st year undergraduates in science and medical courses.
In this HTML eBook I interpret past and present data on human evolution for a general audience, I also spice this eBook with some comic relief so you will not get bored reading my very long eBook. Thus, you do not
need rocket science or a PhD to understand evolution. Where I need to use an obscure scientific term to explain something, I will explain it in simple English. If you
have read books such as Quantum Physics For Dummies or Einstein For Dummies
then you have a pretty good idea what am attempting to do here.
This HTML e-textbook is however not "Human Evolution For Dummies" since I have not yet been hired by the publishers (IDG Books / Hungry Minds/ John Wiley & Sons) of the "For Dummies" books!
This e-textbook is Copyright © 2003-2018 Godfrey Oswald / Oswald Productions, London. U.K.
---------------------------------------------------------------------------------------------------------------------------------------------------------------------------
DETAILED TABLE OF CONTENTS PAGE:
You can click on the links to get to each topic quickly, and then use your web browser
"back button" if you want to return to this contents page. Sorry no index page, but
you can use your browser's Find/Search menu button to look for a particular word you are familiar with. If you have bookmarked this web page,
remember to clear the cache and refresh this web page to show the latest updates, as this web page is constantly updated.
Both paleoanthropology and molecular genetics allow us understand and analyse human origins. Sections B, C and D cover evidence of human origins from paleoanthropology.
Section E will cover evidence of human origins from molecular genetics in detail. Sections F to I complete the story of human origins, using both paleoanthropology and molecular genetics.
Most history books document in great detail human history from about 3,800 B.C. (when Bronze Age civilizations of the ancient Egyptians, Sumerians,
Indian Indus Valley, Assyrians, Chinese, Elamites/Persians, Minoans (forerunners of the ancient Greeks), Hittites and the Babylonians emerge). Since this eBook is not a history book,
there is no need to go into this part of human history from the Bronze Age in detail.
However to finish the story of human origins on a high note, AND to show that knowledge of the basic events that occurred
before and after the Bronze Age are crucial to understanding human origins, sections J, K and L, in this eBook, will to cover the major events
that began with the
invention of agriculture, as well as the start of the non-nomadic lifestyles (most people around the world ceased to be hunter-gatherers), invention of writing
(and the alphabet)
and the early era of the Bronze Age civilizations. A very brief mention is made of the start of the Iron Age.
1) SECTION A: Before the Arrival of Human-like Species
The dinosaurs reign supreme then! I begin this section by taking you on an incredible journey back in time over 500 million years ago. Along the way I explain
how mammals evolved from reptiles, which evolved from amphibians, which evolved from fishes. I explore the very first primitive
creatures to walk on land.
In this section I also explain how and when the mammals evolved and why mammals that lived alongside the dinosaurs
were small and puny but dinosaurs powerful and gigantic. I also look at the very massive mammals known as the Megafauna.
Palaeocene Epoch Primates 60 million years ago. E.g. Plesiadapis and Purgatorius.
Eocene Epoch Primates 56 million years ago. E.g. Adapids, Omomyids, Eosimias (the Dawn Monkey) and Darwinus Masillae (Ida).
The Missing Link Scientists tell us a common ancestor of humans and apes existed before humans and apes separated from the primate ancestry leading to humans 16-7 million years ago.
Primate Classification Why humans are classified as Primates. Includes tables and pictures. In this section I explain the
evolutionary pathway that led to arrival of the ancestors of humans, once divergence from Prosimians had occurred about 35 million years ago:
Gibbons and Siamangs shared a common ancestor with humans 18 million years ago.
Orang-utans shared a common ancestor with humans 12 million years ago.
Gorillas shared a common ancestor with humans 7 to 8 million years ago.
Chimpanzees shared a common ancestor with humans 6 to 7 million years ago.
Human DNA is approximately 98% identical to that of Chimpanzee DNA
Even though on the outside humans look quite different from chimpanzees,
because they both shared a common ancestor 7 million years ago, their DNA is so similar. This segment also looks at what biologists call
HAR or Human Accelerated Regions and how they gave humans several amazing abilities such as beautiful writing or calligraphy which chimps can't do.
Finally, I explain the unique FOXP2 gene mystery in humans and the mystery of the absent Sialic acid called Neu5Gc in humans, as well as
explaining the loss of Siglec 5 expression on T-lymphocytes during human evolution.
2) SECTION B: Primitive Human-like Species Arrive: The Hominids and Early Homo species They did not look like today's modern humans,
but they were our oldest direct ancestors. Starting from 7 million years ago (Pliocene epoch), up to 200,000 years ago (Holocene epoch). A lot of scientists prefer to use the term "hominin" instead of hominid. They both mean the same thing: early human ancestors.
The Ardipithecine Hominids Mostly lived in the trees and on rare occasions came down from the trees and walked for a few minutes upright on the ground every now and then, before returning to the trees to live. Lived only in Africa.
The Ardipithecines are the oldest hominids ever discovered. Evolved from about 7 to 6 million years ago.
BREAKING NEWS: In September 2017, science reports are revealing that hominid
footprints dating almost 6 million years were found on the European island of Crete!! A lot of scientists, including myself,
are left scratching our heads....how is that possible? I discuss this amazing report in detail.
The Australopithecine Hominids Lived only in Africa. Oldest fossils found in Kenya and Ethiopia.
Slept in trees or on the ground. Analysis of their fossils showed that they were well adapted to climbing trees in addition to walking bipedally when on the ground.
Evolved about 4 to 2.1 million years ago. The most famous fossil found to date was the
near complete Lucy fossil found in Ethiopia, using good old detective work.
BREAKING NEWS: In early August 2016, scientists revealed that Lucy may have fatally injured herself falling from a tree.
Australopithecine hominids spent more time on the ground than in trees. They walked for longer periods upright on the ground looking for food. The Australopithecines like the Ardipithecines were all mostly plant-eaters or herbivores.
The Robust Australopithecine Hominids e.g. the famous big-jawed Louis Leakey Nutcracker Man or Paranthropus boisei. Oldest fossils found in Kenya. Mostly lived in the trees. Lived only in Africa from about 2.6 million years ago. Nature's weird experimentation that went extinct.
First Homo species: Homo habilis 2.6 to 2 million years ago.
Lived only in Africa. First to make stone tools so start of Palaeolithic era. However, in May 2015 paleoanthropologists announced a sensational discovery:
stone tools made by ancient human ancestors dating 3.3 million years ago so are possibly
Australopithecine stone tools!! Homo habilis now spent all their time on the ground permanently looking for food and shelter,
and never went up the trees again to look for food or sleep. Began to eat raw meat as well as wild plants and fruits.
BREAKING NEWS: In March 2015, scientists in Ethiopia claimed to have discovered the oldest fossil from our genus Homo: a 2.8 million year old fossil of
Homo habilis. The previous record for the oldest Homo habilis fossil was 2.6 million years old fossil discovered in Kenya.
I examine this new discovery in detail.
Africa thus has the longest record - some 2.8 million years - of human occupation of any continent.
Home erectus/ergaster 2 to 1.5 million years ago. Now permanently based on the ground. Oldest fossils found in Kenya. First to make advanced stone tools and also to leave Africa and venture into unpopulated Asia. May have experimented with making fire to cook raw meat. In this segment I examine in detail
the reasons why eating flesh (cooked or uncooked) helped increase the brain sizes of Homo erectus as well as Homo heidelbergensis
compared to the tiny brain size of Homo habilis and the Australopithecines.
BREAKING NEWS: In early summer 2016, science journal articles reported the
discovery of over 90 remarkable footprints of Homo erectus in Kenya dating back some 1.5 million years ago.
BREAKING NEWS: In summer 2013, Spanish scientists discovered what is surely proof that Homo erectus did in fact reach Europe after all.
The fossils were discovered at Barranco Leon in the region of Orce in southern Spain, and date circa 1.4 million years old. The fossils are thus the
oldest hominid fossils ever found in Europe. I examine this new discovery in detail. N.B. In September 2017, science reports are revealing that hominid
footprints dating almost 6 million years were found on the European island of Crete!! See the sub-heading Ardipithecines above for more details.
BREAKING NEWS: In early September 2015,
South African scientists announced at a press conference that they have discovered a
new species of our genus homo (maybe related to but very distinct from Homo erectus), it was first discovered in back 2013, they are calling the new species:
Homo naledi, and it was provisionally dated 1.95 million years ago two years after the discovery.
I examine this new remarkable discovery in detail.
BREAKING NEWS: In April 2017, one of the discoverers of the Homo naledi fossil, Dr Lee Berger has shocked the entire scientific community by
announcing that Homo naledi is only between 200,000 and 300,000 years old!! and not the 1.95 million years earlier projected. This means that
Homo naledi CANNOT be related to Homo erectus. In this section, I will offer an explanation as to
why the very young dating of Homo naledi may not come as a surprise, I will do this by bringing to the reader's attention the strange case of
Florisbad Fossils or Homo helmei which is 259,000 years old and the strange case of the ancestors of Mr Albert Perry's DNA
which is 338,000 years old!
Homo heidelbergensis circa 900,000 years ago. Oldest fossils found in Ethiopia. First to live permanently in caves (first cavemen) and first to use fire on a regular basis.
BREAKING NEWS: In early 2016, Chinese scientists confirmed that the discovery in 2012 of several Homo heidelbergensis specimens dating back to 900,000 years ago
in Yunxian in Hubei Province in China, makes the origin of Homo heidelbergensis a mystery. The scientists are looking at a possible scenario:
Homo heidelbergensis originated in Asia and spread to Africa and Europe. Thousands of years later
while Homo heidelbergensis living in Europe and Asia evolved into the Neanderthals and the Denisovans circa 350,000 to 400,000 years ago respectively.
In Africa, Homo heidelbergensis evolved into archaic Homo sapiens about 200,000 years ago. The problem with the postulation that
Homo heidelbergensis originated in Asia is that DNA and molecular genetics say otherwise. By the time you read Section E in full, you will see that molecular genetics
shows quite clearly that while Homo sapiens could not have originated in Asia, but originated in Africa, it may have been possible that
the Homo heidelbergensis in Africa DID have an Asian origin. Only DNA can solve this mystery, but up till today, scientists have not been able to extract
Homo heidelbergensis DNA from existing fossils in Africa, Asia and Europe.
Homo antecessor A special European version of Homo heidelbergensis.
Homo neanderthalis (the Neanderthals) Lived only in Europe, North Africa and
western Asia from Middle Palaeolithic era. Often portrayed by the media and in films as being dumb,
they survived for more than 300,000 years compared to the fact that modern (anatomically) humans today
have only existed for 200,000 years (Africa), 70,000 years (Asia), 45,000 years (Europe) and
26,000 years (the Americas). They were the sole inhabitants of much of Europe
during the early to middle stages of the last glaciations of the end of last Ice Age from 450,000 years ago (Middle Palaeolithic era) to about 50,000 years ago
(Late Pleistocene Epoch.
It should be noted that the last Ice Age began the Quaternary Period, and the penultimate part of this period is the Pleistocene Epoch. Today we live in the
part of the Quaternary Period known as the Holocene Epoch
Scientists tell us that at least five major Ice Ages have occurred throughout Earth's history:
the earliest was over 2 billion years ago, and the most recent one began approximately 4 million years ago or the Quaternary Period. In-between each of the 5 major
Ice Ages, over 48 glaciations occurred, each lasting a few thousand years, some glaciations were very harsh while some were not very harsh.
The glaciations of the last Ice Age, which coincided with the arrival of the Neanderthals and modern humans
lasted from about 800,000 years ago to about 12,000 years ago. While the Neanderthals survived the start of the
earliest glaciations of the last Ice Age (from at least 450,000 years ago), modern humans
in Europe arrived around the time of the later glaciations circa 45,000 years ago, which were not as severe as the much colder earlier
glaciations the Neanderthals had to endure.
This section also looks at the oldest caves and cavemen paintings in the world.
Homo floresiensis (or the Hobbits) and the Denisovans Respectively specific East Asian versions of Homo erectus and the Neanderthals.
Oldest DNA belonging to the Neanderthals and the Denisovans is extracted. Respectively 120,000 and 400,000 years old. A big achievement for science.
3) SECTION C: Early Anatomically Modern Humans Arrives 200,000 to 300,000 years ago. Known as (archaic Homo sapiens).
Leave Africa for the 1st time and head to Asia only (possibly reaching as far as Australia, i.e. Mungo Man Fossils). They left behind fossils such as the famous
Skhul and Qafzeh fossils of Israel and the Jebel Faya fossils of the United Arab Emirates, both are at least 120,000 years old!
This first migration of modern humans is the origin of the theory of Mitochondrial Eve (to be discussed in Section E).
This period of time is known as the Late Pleistocene Epoch. I also discuss the accepted two routes,
viz the Northern Route (125,000 years ago) and the
Southern Route (70,000 years ago), which were both taken by
Anatomically Modern Humans as they migrated out of Africa into Asia, Europe and later the Americas.
BREAKING NEWS
The Skhul and Qafzeh fossils in Israel, 120,000 years old and Jebel Faya fossils in the United Arab Emirates, 125,000 years old are no longer the
the oldest archaic Homo sapiens discovered outside Africa. In January 2018, stunned Israeli and American scientists announced that archaic Homo sapiens
fossils found in caves at Mount Camel in Israel, are now the oldest archaic Homo sapiens discovered outside Africa. Dating tests show that
the fossils are at least 177,000 to 194,000 years old. Meanwhile
the Jebel Irhoud fossils in Morocco, 300,000 years old remain the oldest archaic Homo sapiens fossils in the world.
In-between 1987 (when Mitochondrial Eve was discovered) and 2016
molecular genetics supported the scientific view that anatomically-modern humans evolved some 200,000 years ago. But in 2017,
spectacular new fossils of modern humans such as Jebel Irhoud fossils in Morocco revised the earliest date modern humans first evolved as 300,000 years ago and not 200,000 years ago.
This also means the age of the Northern Route must now be revised from 125,000 years ago to at least 199,000 years ago!!
BREAKING NEWS
In February 2018 issue of the British Journal Nature, excited researchers in India and Germany announced yet more amazing ancient modern human facts: on the
basis of advanced stone tools
made by ancient humans discovered in India that have been dated as 385,000 years old, it looks like the current (from 2017) scientific
view that anatomically-modern humans evolved some 300,000 years ago, might have to be revised yet again! But the Indian and German scientists are
very cautious, because the stone tools kind of resemble Neanderthal tools in some ways. So it is early days, as more studies need to be done on the stone tools.
BREAKING NEWS: In October 2015, scientists announced that when early Anatomically Modern Humans migrated out of Africa for the 1st time circa 125,000 years ago,
they reached ancient pre-historic China around 100,000 years ago!
I discuss this amazing find.
BREAKING NEWS: When Anatomically Modern Humans migrated out of Africa for the 1st time (discussed in Section C) and the 2nd time (discussed in Section D),
they encountered the Neanderthals in Eurasia and the Denisovans in eastern Asia. But in December
2015, scientists claim there was in fact a 3rd type of non-Anatomicaly Modern Humans around as well: The so-called Red Deer Cave People or the Maludong. I examine this discovery in detail.
Archaic Humans Begin Wearing Clothes Prior to that all earlier human species above went about butt naked.
The Cro-Magnons Meet the Neanderthals from 45,000 years ago. What was the outcome of the strange encounter? Have a guess.
Oldest Archaic Homo sapiens Revealed Here I provide information on the famous 195,000 year old Ethiopian Omo Kibish fossils, the oldest Early
Anatomically Modern Human fossils discovered (until the amazing June 2017 discovery of the much older Jebel Irhoud fossils in Morocco).
BREAKING NEWS: In early August 2016, Professor Chris Stringer, one of Britain's best known leading paleoanthropologist, presented a ground-breaking
research paper, mentioned in the journal Philosophical Transactions in which he theorises that the lineage that led to anatomically modern humans might well be
at least 250,000 years to 500,000 years old and not well established 200,000 years old as previously accepted by scientists.
Professor Stringer predicts that one day paleoanthropologists worldwide will discover anatomically modern human fossils in Africa and probably elsewhere, that are much
older than 200,000 years old.
I discuss more about this interesting theory in this section. Other over "200,000 years old" examples of Professor Chris Stringer fascinatig prediction
include the strange case of Florisbad Fossils or Homo helmei which is 259,000 years old and the strange
case of the ancestors of Mr Albert Perry's DNA which is 338,000 years old!
BREAKING NEWS:
In June 2017, on the bioRxiv server (a popular repository for biological sciences research work papers)
a recent research paper written by South African and Swedish scientists led by Drs Mattias Jakobsson,
Carina Schlebusch and Helena Malmstrom at Uppsala University in Sweden and the University of Johannesburg and Witwatersrand
University in South Africa
provided crucial genetic evidence that lineage that led to anatomically modern humans is over 260,000 years old,
after DNA testing a rare 2,000 year old fossil. I discuss more of this at the Section C sub-heading
"ARE MODERN HUMANS MUCH OLDER THAN 200,000 YEARS OLD?"
BREAKING NEWS: In early June 2017, excited scientists discovered further proof of Professor Chris Stringer amazing prediction that
the lineage that led to anatomically modern humans might well be over
at least 250,000 years old and not 200,000 years old as previously accepted by scientists (i.e. Omo Kibish fossils in Ethiopia). In Morocco, a team led by anthropologist Dr Jean-Jacques Hublin at the Max
Planck Institute For Evolutionary Biology in Leipzig, Germany discovered fossils of Homo sapiens much older than 200,000 years old. The latest dating estimates indicate that
the age of the Jebel Irhoud fossils in Morocco are over 300,000 years old!
I discuss this rather amazing discovery in detail. See Section C sub-heading
"ARE MODERN HUMANS MUCH OLDER THAN 200,000 YEARS OLD?"
Complete list of Archaic Homo sapiens fossils worldwide.
They were the earliest types of anatomically modern humans. This section also calculates how
long it took for anatomically modern humans to trek from Africa to Europe, Asia and the Americas.
I also take a look at the mysterious Florisbad fossils or Homo helmei
4) SECTION D: Modern Humans (modern Homo sapiens or Just Homo sapiens)
Leave Africa 70,000 years ago and head to Asia for a 2nd Time. This time also travel to Europe and The Americas.
Better known as Later Anatomically Modern Humans, more advanced than archaic Homo sapiens (Early Anatomically Modern Humans).
The Migration of Modern Humans From Africa From the Djibouti coastline onto the Bab al-Mandab or Bab al-Mandeb strait onto Yemen, onto Europe and Asia.
First major migration of Later Anatomically Modern Humans. How long did it take anatomically modern man to reach all parts of the globe from Africa?
From 90,000 years, later anatomically modern humans evolved in Africa, then after thousands of years living only in Africa, a group then migrated to Asia (incl the Middle East)
from 70,000 years ago, reached Europe 45,000 years ago and finally settled the Americas 28,000 years ago.
Scientists have calculated that anatomically modern man only needed to walk 3 miles every 5 years to eventually reach all
parts of the globe except Antartica (which is the only continent with no indigenous population). Professor Chris Stringer
(U.K. Natural History Museum) has calculated that for anatomically modern humans in Africa to have reached Australia 60,000
years ago (i.e. Mungo Man fossils), they only had to travel only one mile each year for next 10,000 years to reach Australia, having left Africa
70,000 years ago. Bear in mind that anatomically modern humans were all hunter-gatherers moving from place to place every few hours (nomadic lifestyle)
and only settled down 12,000 years ago, when agriculture (farming) was invented.
BREAKING NEWS:
In September 2016, the journal Nature reported that
three major independent genetics studies in U.S. and European labs led by Dr Eske Willerslev, examined the nuclear DNA of 787 people from different ethnic groups
around the world. The studies revealed that anatomically modern humans actually left Africa between 50,000 to 80,000 years ago and not the avearge date of 70,000 years ago.
And the migration was via one single dispersal, and not multiple dispersals. Among the different ethnic groups whose DNA was analysed were Australian Aboriginals, Sherpas of Nepal,
North African Bedouins, Cree Native American Indians, descendants of Mayas of Yucatán, Mexico and central America, Europeans,
Han Chinese and West Africans.
The Mount Toba Super Volcano Eruption How more than 80% of early anatomically modern humans went extinct 74,000 years ago (Upper Palaeolithic era).
This section also discusses very briefly why all modern humans today are 99.9% identical, due to the Mount Toba eruption.
It is just 70 genes that make Europeans, Africans and Asians different from one another in physical appearance, e.g. skin colour and hair textrure.
More detailed information on genetics data covering human origins is provided in section E, below.
5) SECTION E: Using DNA / genes to Explain the Ancestry and Origins of Modern Humans The magic of molecular biology used to solve the mysteries of human origins. The year 2013 saw a new world record for the oldest DNA extracted from fossils: 400,000 years old! Not close to the one mentioned in the dinosaur film Jurassic Park
The Origin of Mitochondria. 1 billion years ago, there was no mitochondria but a-proteobacteia!
The Functions of Mitochondria. How human cells with the help of mitochondria, use the Krebs Cycle, the Electron Transport Chain and Oxydative Phosphorylation to make ATP (our energy currency).
Why Mitochondrial DNA Are Very Useful in Studying Human Evolution.
DNA and Genes. To understand
the usefulness of mitochondrial DNA in human evolution we need a basic understanding what DNA and genes are.
Men and Mitochondrial DNA. Why men cannot pass on mitochondrial DNA, but women can.
Mitochondrial DNA, Nuclear DNA and Mutations. Explains how mutations in
mitochondrial DNA are spotted. Includes a look at types of mutations known as SNP or Single Nucleotide Polymorphism, as well as
several updated examples of good and bad mutations that occur in humans.
BREAKING NEWS: In March 2017, the respected journal Nature Biotechnology reported that French biochemists,
using pioneering molecular biology techniques based on Gene Therapy were able to genetically change the faulty genes in the bone marrow of a Sickle Cell disease patient in a way that it started to reproduce normal haemoglobin and ceased making
mutated haemoglobin. Gene Therapy (a product of biotechnology, where boffins seek to repair mutated genes) is fast becoming a way
scientists can change faulty genes in humans! But the technology known as gene therapy is not limited to treating adults and children.
In August 2017 the respected British journal Nature reported that U.S. Professor Juan Carlos Izpisua and Korean-American Dr Jun Wu at the famous Salk
Institute in the U.S. using a gene therapy technique known as CRISPR-Cas9
were able to alter faulty genes in human embryos!!
The faulty genes had a mutation that would have caused several serious genetic diseases in the embryos, had they been naturally fertilized and grew into babies.
This is the first time that gene-editing tools have been used to fix a mutation in cells at the embryo stage. More about CRISPR-Cas9 is discussed in this section.
BREAKING NEWS: In December 2018, the scientific community was shocked to hear that
Chinese researchers were able to use gene-editing tools based on CRISPR-Cas9
to alter (or tweak as reported) the genome of an embryo, during in-vitro fertilization and impant it into the donor of the egg leading to
live birth 9 months later. In doing so, Professor He Jiankui had used CRISPR-Cas9 to create
the World's first designer DNA baby.
It was clearly a big controversy as modern eugenics or genetic engineering is focused primarily on repairing faulty genes (i.e. mutated genes).
But in this case Professor He Jiankui had "created" a baby resistant to a number of serious diseases such as smallpox and cholera.
The jury is out on whether this achievement crossed the line on ethics standards in genetics.
Mitochondrial DNA: Extraction, Isolation and Sequencing. Here I explain how geneticists isolate and sequence mitochondrial DNA from cells. Includes pictures and a detailed look at various fascinating DNA databases such as GenBank and Ensembl.
The Link Between Mutations and Ancestry.
The more mutations (or genetic diversities) in the mitochondrial DNA in a person, then the older that person's ancestry.
The Mitochondrial DNA Genetic Markers (Haplogroups) in Humans. Introduction to Mitochondrial Eve. The oldest MtDNA markers L0 are found in the Kho and San people or Khoisan people of the Kalahari Desert.
How Mitochondrial Eve was discovered. A detailed look at the 1987 sensational and ground-breaking mitochondrial DNA research project carried out by Professor Allan Wilson and his PhD students, Dr Rebecca Cann and Dr Mark Stoneking
at the University of California, Berkeley in the U.S. Also discusses DNA Molecular Clocks.
How Does Genetics Show an African Origin of Humanity?
During DNA profiling using Mitochondrial DNA for European and Asian females, the first major genetic markers to show up is the African genetic marker L3. Likewise
during DNA profiling for European and Asian males using Y-Chromosome DNA, the first major genetic markers to show up is the African genetic marker M168. It is the order of these two genetic markers and other markers that show up during DNA profiling, that allows scientists to trace the exact journey taken by humans as they migrated out of Africa into Asia, Europe and the Americas.
Human Mitochondrial DNA Genetic Markers (Haplogroups). A much closer examination of all the major MtDNA Haplogroups or genetic markers in Africans, Asians and Europeans. Includes detailed world map of the various MtDNA haplogroups.
The Y-Chromosome DNA Genetic Markers (Haplogroups) in Humans.
Introduction to Y-Chromosome Adam. A look at the major Y-Chromosome DNA Haplogroups in humans.
Includes three very detailed worldwide Y-Chromosome DNA Haplogroup maps and two detailed Y-Chromosome DNA phylogenetic tress, the amazing mystery of
Mr Albert Perry's very ancient DNA (338,000 years old!) and a look at the remote Mbo, Bangwa and Bakola ethnic groups in Cameroon.
The oldest Y-Chromosome (male) DNA markers, the A00 and the A0 markers are found in the Mbo, Bangwa and Bakola
people of Cameroon.
Y-Chromosome DNA Final Analysis Brief summary of human Y-Chromosome DNA Haplogroups, includes 3 very specific Y-Chromosome DNA Haplogroup maps for Africa, Europe and Asia.
The Big DNA TEST! A brief look at firms that help us analyse our Y-Chromosome DNA and Mitochondrial DNA,
as well as Autosomal DNA, for genealogical purposes tracing our ancestors back in time. Includes the top 10 DNA testing firms in the world.
I did my MtDNA and Y-DNA tests back in 2013. I was amazed to be told my DNA test results show
that although I was born in London, U.K. I have Scottish, Tuareg, and West African DNA!
My haplogroups are: E1b1a8a, L3e2a1b1 (West African DNA, 90%); and traces of H1v1b (North African Tuareg DNA, 6%) and R1a1a/M17 (Scottish DNA, 4%).
After much research I have concluded that the Tuaregs (originally from North Africa) and who are versatile nomads,
were very common in parts West Africa from the 1500s, and most probably a group of them had a chance sexual encounter with
one of my distant ancestors somewhere in West Africa circa late 1600s. My trace Scottish DNA comes from Scottish
missionaries who came into contact with my father's maternal ancestors in the early 1800s.
But I am proud of my European (Scottish) and African ancestry. Have you had your own DNA ancestry test yet?
I also discuss the SNPedia and Promethease Databases used in DNA ancestry testing.
Nuclear DNA Genetic Markers in Humans. Introduction to using Nuclear DNA (or Autosomal DNA) in studying human evolution and migration.
With both MtDNA and Y-Chromosome DNA (chromosome number 23), the two favourite
sources for human ancestry research and population genetics projects, what about the DNA found in the nucleus (chromosome numbers 1 to 22) ? Includes the use of DNA sequences known as Microsatellites (or Short Tandem Repeats or STR). I also explore how Short Tandem Repeats changed forensic science forever.
6) SECTION F: Modern Humans Arrive Europe Circa 45,000 years ago such as the Cro-Magnons. Due to the last Ice Age, modern humans arrived Asia and Australia before Europe.
The Origin of Ethnic Groups Seen Today As early modern humans migrated from Africa into much colder climates in Europe and western Asia from 70,000 years ago, they had to evolve to adapt to brand new environments, leading to the evolution of physiological differences
not found in those humans who did not take part in the migration, such as the evolution of skin colour changes.
BREAKING NEWS:
In February 2018, British scientists at University College London and the Natural History Museum London were able to analyse
the genome (for genetic markers like SNPs, discussed in Section E) of the famous 10,000 year old Ceddar Man fossils discovered
at Gough's Cave in
Somerset (discussed in detail in Section I) and made an important discovery: SNPs for the genes that give dark skin colour in
modern humans i.e. the MC1R gene, were found in Cheddar Man's genome. Instead of finding only SNPs for SLC24A5 genes on chromosome 15 and no SNPs for MC1R genes on chromosome
16 on Cheddar Man's decoded genome, they found SNPs for MC1R genes instead on chromosome 16 and no SNPs for SLC24A5 genes on chromosome 15. This suggests the SLC24A5 gene that
gives light skin colour in modern humans may have only appeared in some migrants to Europe
after at least 10,000 years ago, and not before 10,000 years ago in migrants into Europe. Recall that modern humans arrived Europe roughly 45,000 years ago. This also means that
while evolution got to work enabling lighter skin colour to be manifested in modern humans migrating from Africa to Europe, not all the migrants had
lighter skin colour changes to
enable the skin absorb more sunlight to make vitamin D in cold climates. Some early modern humans arrived modern Europe with darker skins colours
(as supported by the Cheddar Man discoveries in February 2018).
But Natural Selection was the reason why all the remaining darker skin ancient human migrants in Europe had lighter skin colour eventually.
Today the MC1R gene remains inactive in modern day Europeans (i.e. European ancestry) on chromosome 16 due to a permanent mutation, meanwhile
active variants of the SLC24A5 genes are found on chromosome 15 in modern day Europeans (i.e. European ancestry). But an analogy of the MC1R gene presents itself when modern Europeans
visit hot tropical climates for holidays such as Brazil or North Africa and get a temporary skin tan. The skin tan is not due to the inactive MC1R gene being reactivated but simply the exposure to longer periods
of the sun in hotter tropical climates directly causing melanin genes in skin cells to produce large amounts of melanin.
7) SECTION G: Modern Humans Arrive the Middle East, Asia and Australia From 70,000 years ago,
(start of Upper Palaeolithic era). First the Middle East proper, such as the 60,000 year old Dan David Manot Fossils in Israel.
Then onto Asia proper, E.g. the Sentinelese (Nicobar and Andaman Islands, 55,000 years ago); Orang Asli and Semang (Malaysia, 50,000 years ago);
Niah Caves fossils (Malaysia, 46,000 years ago); Maniq (Thailand, 44,000 years ago); Aeta or Ayta (the Philippines, 42,000 years ago) and the
Aboriginals (Australia, 40,000 to 50,000 years ago).
BREAKING NEWS: In July 2017, the respected journal Nature reported that scientists in Australia have discovered artefacts left over by
the Aboriginals of Australia seem to indicate that
the Aboriginals of Australia arrived there much earlier than the 40,000 to 50,000 years ago. Preliminary dating
suggests that the Aboriginals arrived Australia about 65,000 years ago.
8) SECTION H: Modern Humans Arrive the Americas 26,000 years ago. Ancestors of the Native
American Indians and Mayas and Aztecs of Mexico (North America) as well as the Incas of Peru and other earlier civilisations in South America.
NEW UPDATED DATA
An eagle-eyed reader in Texas, USA has pointed out a potential error in the dates for human settlements in the 1998 Science Fiction
film The X-Files. At the begining of the movie, we are shown two early modern humans walking along icy Texas, circa 35,000 BC!!
As my science blog shows, modern humans had not yet reached the Americas from Asia in 35,000 BC! But since it is a movie, the date error is understandable.
9) SECTION I: Special Look at Britain Between 500,000 BC and 5,000 BC Fascinating facts and figures revealed. In
this section I include details about
Gough's Cave and Blick Mead. Both Mesolithic sites date from 10,000 years ago and are the oldest surviving sites of continuous human habitation in Britain today.
10) SECTION J: Agriculture and the Arrival of Civilisations 12,000 years ago (10,000 BC). Start of Neolithic era. How
small settlements in ancient Middle East, developed into city states with sophisticated cultures, starting with the famous Fertile Crescent in Iraq: The Cradle of Civilisations
11) SECTION K: Bronze Age Begins 4,000 BC. Humans leave behind stone tools forever, after having used only
stone tools from 2.6 million years ago. Section includes a look at
the invention of human writing systems (and the alphabet); the invention of Zero and place value in early numeral (number) systems and
various early numeral systems around the world; the early era of the major Bronze
Age civilizations (ancient Egyptians, Sumerians, Indian Indus Valley, Assyrians, Chinese, Elamites/Persians,
Minoans (forerunners of the ancient Greeks), Hittites and the Babylonians); the Indo-Europeans and the Basques and the Rh-Negative mystery.
12) SECTION L: Iron Age Begins 1,500 BC. Humans start to make better and stronger tools than Bronze Age tools.
Sources, Further Reading and Disclaimer A full list of every single source used
for the HTML eBook as well as other sources consulted (I could not have written this very long HTML eBook without so much research work in libraries
reading lots of books and watching so many TV documentaries about evolution and the origins of humans). My list of further reading includes several books to read.
The Top Eight TV Documentaries on Human Evolution to Watch In this section, I preview
eight documentary TV programmes where eight different people travel the whole world for several days, meeting different people, exploring different cultures
and visiting ancient sites used by our human ancestors. They all explain human evolution and the out of Africa migration in a very beautiful narrative way. The seven presenters previewed are:
Sir David Attenborough, Mr Eddy Lzzard, Dr Spencer Wells, Dr Alice Roberts, Dr Niobe Thompson, Dr Rick Kittles
(with some mention of Dr Henry Louis Gates, Jr.), Dr Stephen Oppenheimer and Dr M Hammer et al.
.
An important Disclaimer Statement is also included at the very end of this HTML eBook. And just after the disclaimer, I take a very brief look at the
sensitive relationship between the Darwin's main theory of evolution and the concept of a Supreme Being or the existence of God.
Here is a brief Evolution 101 basics on how it all started...... sometime before all of us began our teens, we were taught in school the basics of evolution of animals:
mammals evolved from
reptiles, which evolved from amphibians, which evolved from fishes. Later on in high school
we learn the rest of the story.
Thus once upon a time, going back 570 million years ago (Cambrian Period), only prehistoric fish such as Lancelets
and ancient lamprey ancestors alongside plants living in water, exist on earth. 450 million years ago the very first primitive ancestors of both insects and land-based plants appear on land, which was previously barren with no land-based living thing. Plants living in water such as Algae (e.g. Seaweed), appeared first before land-based plants. Algae are just like plants because they contain chloroplasts, which use sunlight to generate energy (via photosynthesis).
Meanwhile back in water, 430 million years ago, other fishes such as ancient ancestors of sharks and rays appear.
Then 400 million years ago (Silurian Period), evolution kicks in an extraordinary way, and one day
certain prehistoric fish (ancestors of today's Lungfish) develop both lung-like organs or proto-lungs
(to breathe in air, ditching their gills in the process), and proto-limbs (which were attached to the front and back fins), climb out of the water and
go on dry land for a while, to become the first Tetrapods (or four-legged vertebrates).
As tetrapods moved onto dry land, they experienced natural selection pressures
that helped shaped many adaptations for a terrestrial (or land-based) way of life:
evolving into amphibians, reptiles, birds and mammals. One of the very best and almost complete fossilized Tetrapod
was the extinct creature named TikTaalik dating 370 million years ago (Devonian Period), which was
discovered in Greenland in 2006. It lived in both shallow water and on dry land as its skeleton revealed. But TikTaalik was not yet a true amphibian, but simply represents a transition from prehistoric fish to prehistoric amphibians.
TikTaalik had a combination of features that show the evolutionary transition between swimming fish and their descendants, the four-legged vertebrates: a clade which includes amphibians, dinosaurs, birds, mammals, and of course, humans.
During the Carboniferous Period 360 million years ago, when lycophyte trees a.k.a Lycopods, quillworts and spike-mosses
(oldest species of plants today and oldest surviving vascular plants) ruled the land, we
witness the arrival of the very first Tetrapod to evolve into prehistoric amphibians or the Temnospondyls (ancestors of today's frogs, toads and salamanders).
They join the prehistoric fish who stayed in water as the sole two inhabitants of the earth at that point in time. One of the largest and oldest amphibian fossil today is that of massive 90 kg species known as Eryops, which dates back to 270 million years ago. It was discovered in Texas, U.S.
Eryops was a massive semi-aquatic amphibian (now extinct) and was more than 2 metres (6 feet) long, it lived during the Permian Period about 260 million years ago, so long before dinosaurs had evolved .
All Amphibians have two similar features, thanks to evolutionary link to fishes. They have to lay eggs in water (to stay moist), and adult amphibians have to remain moist at all times. So
amphibians have to spend their life in BOTH water (only to lay eggs and remain moist), and on land to look for food, sleep, play and rest.
Since amphibians have lungs and not gills, they can only live in water for a short period of time, enough time to lay eggs and get moist again.
The larvae form of amphibians live in water and have gills.
When larvae grow into their adult form, they develop lungs (except for the strange Axolotls larvae which retain their gills as adults!).
When certain types of amphibians decided to stay much longer on dry land, and rarely in water they had to evolve two very important things:
First of all, they evolve to lay their eggs within water-tight hard shells (eggs remain moist inside shells), meaning the eggs no
longer had to be laid in water to remain moist. Secondly because they were going to live on land most of the time,
they evolved to have dry scales (ditching moist scales meant
no need to return to water to re-moist themselves as amphibians do after getting a bit dry while on land).
These types of land-only amphibians became reptiles.
Prehistoric reptiles
join the show roughly 320 million years ago. Several different groups of prehistoric reptiles later evolve. Due to natural selection pressures, the top three dominant ones to evolve were:
1) The Pelycosaurs (320 million years ago), such as the strange looking creature called Dimetrodon 290 million years ago, were the earliest, and most primitive of the prehistoric reptiles. The
Permian Mass Extinction 250 million years ago, wiped out the 95% of the Pelycosaurs (who are thus extinct today), but the remaining 5% that did survive
evolved
into the more advanced form of reptiles called Synapsids, ancestor of the Therapsids. N.B. although Pelycosaurs fossils resemble those of dinosaurs, they ARE NOT dinosaurs, which had not yet evolved!
Dimetrodon is an extinct pelycosaur that lived during the Early Permian Period. Dimetrodon is mistaken for a dinosaur more often than any other prehistoric reptile--but the fact is that this creature lived tens of millions of years before the first dinosaurs had even evolved.
2) The Sauropoda or the Sauropods (280 million years ago, or during the Permian Period), includes extinct Sauropod dinosaurs, ancestors of all living reptiles today as well as
the Archosaurs. They survived the Permian Mass Extinction.
Prehistoric crocodiles evolved from Archosaurs 200 million years ago and the
very first dinosaurs evolved from the Archosaurs 230 million years ago.
Yes, crocodiles are the ancient cousins of the dinosaurs since they both descend from the archosaurs.
You can understand why crocodiles have been called Living Fossils.
Crocodiles today have not changed from how they originally were 200 million years ago!
But dinosaurs (though extinct today), DID change before extinction.
The early types of dinosaurs (and the crocodiles) had no proper hip bones (so had very short legs overall,
just like their amphibian ancestors), so like crocodiles who also had no proper hip bones,
when the early forms of dinosaurs crawled, it was very awkward, their lower parts (i.e. stomach etc) was just too close to the ground
and this was to a great disadvantage, to things like trying to crawl faster or efficiently on land. The later and newer forms of dinosaurs
evolved true hip bones, so had much longer legs overall and could move
more efficiently and faster on land. When the ancestors of birds arrived,
they too chose to have true hip bones. All mammals too chose to have true hip bones
(ilium, ischium, and pubis bones).
3) Therapsids (220 million years ago) such as the reptile called Lystrosaurus
(which evolved from Synapsids) also survived the Permian Mass Extinction. The very first Prehistoric mammals
evolved from the Therapsid reptiles about 210 million years ago, e.g. as seen in two fossils: Tritheledonts or Ichthyosaurs (tiny reptiles the size of rats which dates 200 million years ago), and Hadrocodium wui (which dates 195 million years ago),
during the Jurassic Period. While the Sauropod reptiles had dry scales just like the transitory amphibians that evolved into reptiles, the Therapsids evolved (via the EDA gene) to grow lots of hair (i.e. fur) on top of the scales: a much better way to keep warm than basking motionless in the sun as the main types reptiles did. This new trait allowed
the Therapids to control their body temperature in a rudimentary way (not as advanced as mammals do today, but still transitory). About 180 million years ago prehistoric mammals
split into three main groups: The Marsupials (e.g. Kangaroos); the
Monotremes or egg-laying mammals (e.g. the eccentric duck-billed platypus and spiny anteaters);
and the Placentals (majority of mammals). The Monotremes evolved first, about 180 million years ago
from the Therapsids and like all the Therapsids, they lay eggs, while the other two groups, Marsupials and Placentals (also called live-birth mammals) evolved later on.
All primates including humans evolved from the Placentals.
About 100 million years ago a specific branch of the
Placentals split from all the other Placentals to evolve separately. This specific branch developed one peculiar feature not
found in all other mammals: a flexible form of middle ear auditory ossicles: 3 ear bones known as
the malleus (or hammer), the incus or anvil, and the stapes, or stirrup.
Other mammals have 3 ear bones too. The middle ear also explains why mammals, as a group, have the sharpest hearing on Earth (dogs, cats and bears are good examples).
This specific branch called Archonta (Euarchonta) by biologists is
believed to have evolved into the ancestors of Scandentia (the tree shrews) AND the ancestors of
Plesiadapiformes, (the earliest extremely primitive forms of primates that would later appear 67 million years ago
starting with the famous Purgatorius ceretops, the very first primitive primate). Both Scandentia and Plesiadapiformes looked so similar: same shape, small mammals the size of rats with brown fur and fantastic sense of smell. In fact many biologists consider tree shrews today (Tupaia belangeri) to be a primate as well! Like all other primates, tree shrews among other things have these specific primate features: advanced form of auditory ossicle, a tooth comb, a Postorbital bar, and an expanded Neocortex. But many differences still exist that could exclude tree shrews from belonging to Primates: offspring at birth are precocial (e.g. when fawns are born, they almost immediately stand up on their own and soon are able to run away from danger), but in tree shrews it is the opposite, offspring are born helpless at birth, i.e are always altricial
(but human babies are altricial too, but technically secondarily altricial!). Another difference is that
the lateral and calcarine sulcus (which processes visual information)
are absent in tree shrews brains but always present in all primates.
Give or take the tree shrew, which share a common ancestor with primates and the flying lemurs,
is a living version of the original primate.
Plesiadapiformes and Purgatorius will be discussed in great detail later on below,
at the Palaeocene epoch part of section A.
You can read more about how fish evolved into amphibians, reptiles and mammals from this very popular science book (made as a 3-part TV series):
Your Inner Fish: The Amazing Discovery of our 375-million-year-old Ancestor by Neil Shubin, ISBN-13: 978-0141027586, published in 2009.
There is even more evidence of our evolution from fish, amphibians and reptiles. Anatomy students get the chance to see the different stages of development of a
human embryo: in-between the first few weeks, the human embryo passes through several stages when it looked just like a fish, an amphibian and a reptile, before
it started to look more like a mammal and human. This amazing resemblance of human embryos, at a stage in development, to fishes and amphibians etc
was first documented in detail by German scientists Karl Ernst von Baer and Ernst Haeckel (who called it Recapitulation). You can read more
about evidence of our evolution from fish, amphibians and reptiles, in the early parts of the amazing book by Alice Roberts called
The Incredible Unlikeliness of Being: Evolution and the Making of Us, published in 2014.
RECAP:
570 million years ago prehistoric fishes pass on two eyes, one nose and one mouth (with teeth) that eventually made it's way via
evolution millions of years later to humans. Yes fish do have teeth: the bloodthirsty Piranhas of South America, are good examples
500 million years ago prehistoric fishes pass on the rigid backbone that eventually made it's way via evolution millions of years later to humans as the spinal column.
350 million years ago prehistoric amphibians pass on one tongue and also 4 limbs that eventually made it's way via evolution millions of years later to humans as two arms and two legs.
310 million years ago a specific group of prehistoric reptiles pass on two sets of 5 digits that eventually made it's way via evolution millions of years later to humans as five fingers and five toes.
You can read more about the start of the Age of the mammals from this exciting book:
The Beginning of the Age of Mammals by Kenneth D. Rose, ISBN-13: 978-0801884726, published in 2006.
Just before 150 million years ago, the Sauropod reptile named Archaeopteryx over time evolved wings and
took to the skies to fly and become prehistoric birds. In 1995,
Chinese boffins discovered that some prehistoric birds had evolved 160 million years ago from
flying dinosaurs.
Archaeopteryx, the Famous "Dino-Bird" was a strange bird-like dinosaur (or dinosaur-like bird) and still mystifies generations of palaeontologists, who continue to study its well-preserved fossils to tease out hints about its appearance, lifestyle and metabolism.
Thus just after the
great dinosaurs like the vicious Tyrannosaurs Rex (T-Rex) vanished forever from the Earth 65
million years ago (at the end of the Cretaceous Period: which ran from 140 to 65 million years ago), there were no humans, apes or monkeys on earth, i.e. zero
higher primate or Anthropoid population. There were just primitive fish (including the famous coelacanths and lampreys), primitive amphibians, primitive reptiles
(including crocodiles), primitive birds and small primitive
mammals (e.g. small primitive Afrotheres, small insectivores and small rodents).
The Very First Mammals AFTER the Dinosaurs Said Goodbye
Almost all ancestors of today's major mammals (excluding the rodents and insectivores) only evolved AFTER the dinosaurs perished. Recall that while the dinosaurs were around, evolution kept the sizes of mammals to a bare minimum: the mammals were small (the size of rabbits or less). Once the dinosaurs went extinct, evolution allowed
several subsequent mammal species to be much larger than rabbits, e.g. elephants and bears. Here is a brief look at the dates of first appearance of a selection of mammals:
Ancestors of elephants, sea cows, aardvarks, deers, sheep, antelopes, pigs, goats, cattle, hippos, camels, horses, rhinos, and giraffes evolved 35 to 23 million years ago (most of the ungulates); ancestors of the big five cats (the lion, tiger, snow leopard, jaguar and leopard) and as well as wolves (ancestors of todays domestic dogs), jackals, coyotes, hyenas, pandas and bears (brown, polar etc) evolved from 20 to 15 million years ago. However ancestors of insectivore mammals (e.g. moles, shrews, solenodons, tenrecs, hedgehogs etc) and rodents (voles, mice, rats, rabbits, squirrels, capybaras, hamsters etc) and bats had already evolved some 120 to 80 million years ago (Cretaceous Period).
Hang On a Moment: Why On Earth Did Evolution Keep Mammals Small and Puny While
Keeping Dinosaurs Powerful and Gigantic?
I asked myself that several times and came up with a possible answer after reading a few popular dinosaur books, among them: Dinosaur Heresies: New Theories Unlocking the Mystery of the Dinosaurs and Their Extinction by Robert Bakker and Dinosauria by David B Weishampel. First of all Dinosaurs evolved 230 million years ago and mammals evolved 195 million years ago. So dinosaurs had a head start of about 35 million years. By the time the major small mammals appeared (e.g. rodents, 100 million years ago), the dinosaurs were already the dominant masters and predators on the planet.
Dino experts tell us that dinosaurs were massive in bulk, but equally agile, fast, and intelligent. There are times when evolution does wonderful stuff AND crazy stuff. As you read this scientific HTML eBook, you will come across evolution trying to be clever but making mistakes in the process (you will read an example of this from the paradox of Sickle Cell Anaemia in Section E). When early major mammals such as rodents, finally appeared during the age of the dinosaurs, there would have been enormous food sources pressures. The dinosaurs were both plant and meat eaters and took most and the best food sources available. The early mammals either had to live on small scraps of food left over after the dinosaurs had their fill, or on food the dinosaurs did not bother to eat such as insects and worms. So most early
mammals ate insects and worms! But even that food source was not abundant and with early mammals all chasing the same food sources, something had to give. In places that were islands, early mammals were subjected to an evolutionary safety net known as Island Dwarfism:
they began to shrink in size over the generations. Island Dwarfism occurs when inhabitants on island, separated from other major areas over million of years, and limited food sources available, begin to shrink in size, due to natural selection stimulus, so that they can survive on that isolated island much longer. Those early small
mammals not living on islands, discovered that they could survive being gobbled by the larger dinosaurs, if they were small enough to escape detection! Dinosaurs with their massive bulk would probably eye-up mostly larger prey than look hungrily at a smaller prey. So evolution kept these early mammals as small as possible to survive the age of the dinosaurs. Once the dinosaurs were gone, evolution changed tact and allowed mammals to grow bigger (since their main predator was no longer around).
Pretty smart huh? Not so fast!! Although evolution allowed early mammals to increase their bulk (height and weight),
after the demise of the dinosaurs, some early mammals overdid it. Welcome to the period of the
Megafauna: massive gigantic mammals. The Megafauna included the Giant Kangaroo (500 pounds or 230 Kg),
the Diprotodon Koala-like mammal (5 tons); Steppe Mammoth (15 tons!!); Sabre-Toothed Tiger (881 pounds or
400kg); Megatherium Sloth (4 tons!); Gigantopithecus or King Kong (920 pounds or 440kg); Short-Faced Bear
(1 ton or 900 kg); the list goes on and on (I have avoided including height figures alongside weight figures,
because it would simply evoke fear in many readers!) Sounds familiar? one giant category of massive predators
(dinosaurs) goes and another impromptuly drops by (Megafauna). Luckily today the Megafauna are long gone
(thanks to evolution and a stroke of luck that occurred around the time the last Ice Age ended), and the largest mammal today (Whales) lives in water and feeds on small fish and
the largest land mammals today (the African Elephants) are all herbivores! phew!
Today, humans are the current dominant masters and predators on the planet. You can read more about
what exactly happened to the early mammals after the dinosaurs said good bye in this text:
After the Dinosaurs: The Age of Mammals by Donald R. Prothero, ISBN-13: 978-0253347336.
Did You Know That?
One type of ungulate 43 million years ago was called hyracotherium, a very tiny version of a modern horse, the size of a cat! Was this a by-product of Island Dwarfism on mainlands?
However crocodiles, coelacanths and lampreys which were around the time of the dinosaurs, still survive today, and so are termed living fossils.
No primates had yet evolved, until scientists discovered there was in fact one primitive
primate that they had overlooked: Purgatorius. That leaves a big What If:
What if the dinosaurs had not been wiped out at the end of the Cretaceous Period?
What if the Megafauna came into existence during the time of the dinosaurs? No one knows really.
Did You Know That?
Many living fossils such as lycophytes trees, crocodiles, coelacanths and lampreys today have bizarre and eccentric traits
that make them seem more like aliens from outer space than anything from this world.
They have often survived one or more mass extinctions. In-between now and 440 million years ago,
there has been 5 huge Mass Extinction Events, and the
Permian Mass Extinction, (caused by a massive Russian super-volcano explosion in Siberia) was the largest ever. All life on Earth today is
descended from the 4% of species that survived the Permian Mass Extinction.
Our own human ancestors 74,000 years ago were almost wiped out when a massive
super-volcano explosion occurred in Indonesia
(Mount Toba)...... a very close mass extinction of ancient humans was averted!
Many scientists consider living fossils to be
rare glimpses at how life on Earth was long long ago (sort of millions year old time capsule).
The most famous mass extinction familiar to most people today is the devastating K-T Mass Extinction that wiped out the
dinosaurs (and any living species over 50kg).
While crocodiles and coelacanths today survived the K-T Mass Extinction, lampreys alongside the lycophytes and horseshoe craps seen today all
survived both the Permian Mass Extinction and the K-T Mass Extinction, as well as other mass extinctions such as the Devonian Mass Extinction. You can read more about all the Mass Extinctions of the past and the terrible effects they caused in this enjoyable book:
Great Extinctions of the Past by Randi Mehling, published 2007 by Chealsea House. ISBN-13
9780791090497.
Here is brief but fascinating factual look at human evolution
from about 64 million years ago, i.e. the Palaeocene epoch: 64 to 56 million years ago, to the Iron Age of
1500 BC backed up with archaeological, historical and genetical evidence. Periods are highlighted in
green colour and names of species in yellow colour.
A Short Note on How Scientists Date Ancient Fossils Today
Written history only began 5000 years ago, when mankind invented writing for the first time in ancient Egypt and ancient Iraq
(then called ancient Sumer or Mesopotamia).
Ancient human (e.g. Cro-Magnon) cave paintings date further back to 40,000 years ago, and do us tell stories about how life
was back then. However
dating artefacts, before writing and cave paintings were invented, is only possible by using specific scientific techniques.
In 1960, Dr Willard Frank Libby received the Nobel Prize in Chemistry for
discovering that measuring radio carbon-14 decay can be used for age determination in archaeology. Since then between six and eight
major
ways of dating fossils that are from
several thousands to several millions of years old have been developed. Most are based on either
decays measurements or ratio measurements. Six of them are:
radio carbon dating, radio rubidium-strontium dating, radio potassium-argon dating, radio argon
dating, electron spin resonance and thermoluminescence. An example of ratio measurements is
radio potassium-argon dating which determines the age of fossils by
measuring the ratio of radioactive argon to radioactive potassium in the fossils being tested.
Thermoluminescence is the property of some ancient fossils which have accumulated energy over a long period of becoming luminescent when pretreated and subjected to high temperatures, and this property used as a means of dating ancient ceramics and other artefacts. Meanwhile
Electron Spin Resonance (or ESR) has been used for dating of archaeological materials such as quartz, flints, carbonate crystals, and hominid fossils remains, for nearly 50 years. The technique is based on the fact that certain crystals behave as natural dosimeters (a device used to measure an absorbed dose of ionizing radiation). This means that electrons and holes are accumulated over time in the crystal lattice induced by surrounding radiation. The age is obtained by calculating the dose received compared to the dose rate generated by the surrounding environment, mainly radioisotopes K, U, and Th.
An example of decay measurements is seen in radio carbon-14 or radio rubidium-strontium dating.
For instance the latter works by
estimating the age of fossils from measurements of the amount of the stable isotope
strontium-87 formed by the decay of the unstable isotope rubidium-87
that was present in the fossils or surrounding rocks
at the time of its formation.
Fossils that are over 1 million years old are best dated with
radio potassium-argon dating or
radio argon which for some reasons gives very accurate results, especially if item to be dated is
over 3 million years old:
The potassium-argon dating method has been used to date the
age of some meteorites as old as 4,500,000,000 years or 4.5 billion years!
Fossils under 1 million years old are best dated
with radio carbon-14, electron spin resonance or thermoluminescence. Those that average thousands of years old are best dated only with
carbon-14.
How do scientists date stuff without fossils? When scientists want to date organic stuff, biological matter, lifeforms etc (not fossils), they use a very good molecular biology technique known as DNA Molecular Clocks. Today DNA Molecular Clocks and fossils are the best dating tools for scientists. DNA Molecular Clocks are discussed later on in the huge genetics tutorial of this HTML eBook at Section E.
A hungry T-Rex on the rampage looking for more tasty food, after feasting on a kill earlier on.
Primates are mammals that are divided into Prosimians
(including aye-aye, bushbabies or galagos, lemurs (these three only found in Madagascar), lorises,
pottos, and tarsiers) and Simians also known as
Anthropoids or higher primates (i.e. humans, apes and monkeys)
Plesiadapis was first discovered in 1877 by Paul Gervais,
a French palaeontologist and professor of zoology. Since this discovery many other remains of Palaeocene epoch
Plesiadapis (or the Plesiadapiformes) have been discovered with some of the best and most complete discoveries coming from France. Skin with fur (a characteristic of all mammals) are also known to be preserved as carbonaceous film, a preservation process where intense pressures and heat from the weight of overlying sediments press down upon a fossil creating a print of the soft tissues in the form a thin layer of carbon upon the rock. Because carbonaceous film is only known from Europe and North America it is thought to have travelled across Greenland when an ancient land bridge still connected these two parts of the world, (at this period in time North America was still connected to Europe. but not South America).
Plesiadapis tricuspiden is the most important species identified. All Plesiadapiformes i.e Plesiadapis, unfortunately went extinct
57 million years ago, just before the start of the Eocene epoch 56 to 34 million years ago, paving way for the euprimates.
Dr Robert D Martin in his book Primate Origins and Evolution: A Phylogenetic Reconstruction, Princeton University, New Jersey, 1990,
which is over 800 pages, provides a comprehensive study of these fascinating ancient primates, the size of rabbits.
He has been studying Palaeocene epoch and Eocene epoch primitive primates for over two decades.
Professor Alice Roberts in her book, Evolution: The Human Story, Dorling Kindersley, 2011, points out the existence
of a very primitive Plesiadapis that actually lived during the Cretaceous Period, 140 to 66 million years ago.
It has been called Purgatorius ceretops and are thought to be the ancestor of Adapids and Omomyids (discussed below).
Primate biologists consider Purgatorius to be a very early member of the Plesiadapiformes.
Because it was very very primitive, Purgatorius is not considered to be an Euprimate or true primate. Only Eocene epoch primates are considered as euprimates. Purgatorius was radio potassium-argon dated to an astonishing 67 million years old!! and was the size of rats.
Did You Know That?
Around the time Purgatorius evolved, the continents were in other locations and they had somewhat different shapes. Originally all the continents were joined together as one large mass called Pangaea and from 200 million years ago Pangaea began to separate
into individual continents and each drifted apart slowly over millions of years. North America was still
connected to Europe but not to South America. Madagascar slowly split away from Africa,
India was not yet part of Asia but heading towards it (the collusion caused the Himalayas mountain range) due to Continental Drift. Australia was much closer to South America and Antarctica (Gondwana) and very very far away from Indonesia than it is today.
Most land masses had warm tropical or subtropical climates.
Because of this, it is unclear where exactly this Palaeocene epoch primitive primate originated, although the oldest fossils appear in North America.
NEW UPDATED DATA
Purgatorius ceretops was indeed the only living, but very primitive primate alive around the time the dinosaurs began to disappear after the massive asteroid struck. According to the 1 hour Animal Planet TV documentary (October 2013) called Animal Armageddon: Purgatorius , when the
8 mile-wide asteroid of the Baptistina family, struck the earth (ground zero was Chicxulub,
just off the Yucatan peninsula in Mexico), releasing the equivalent TNT energy of about
500 megaton atomic bombs causing the K-T Mass Extinction, Purgatorius was saved from extinction, because its small size allowed it burrow deep into the ground and hide from the adverse climatic effects caused by the massive asteroid. A few days after the huge asteroid impact, this lucky primate bravely came out from its safe hole in the ground (where it had taken refuge) permanently and began to multiply and then evolved into
Plesiadapis species, then millions of years later evolved into the
first true primates or Prosimians (Adapids and Omomyids) from whom other primates like humans evolved from.
Crocodiles are good example of reptiles that survived the K-T Mass Extinction, (just like Purgatorius and other small mammals (insectivores and rodents) survived the K-T Mass Extinction).
Just how they did it, despite their massive size, we will never know.
Purgatorius ceretops, the world's oldest primate was a rodent-like climber. Scientists also liken it to another precursor primate called Dryomomys. Purgatorius has been considered a plausible ancestor for primates since it was discovered. By 2010, results of phylogenetic analyses that incorporate new data from these fossils support Purgatorius as the geologically oldest known primate. Notice the five digits it inherited from reptiles, this was passed on to humans as 5 toes and 5 fingers! Remember that
while Purgatorius ceretops evolved 67 million years old, there are other small mammals that predate it. Recall that I explained that
ancestors of insectivore mammals (e.g. moles, shrews, solenodons, tenrecs, hedgehogs etc) and rodents (voles, mice, rats, rabbits, squirrels, capybaras, hamsters etc) and bats had already evolved some 120 to 80 million years ago (Cretaceous Period). Going back further, recall that the oldest fossil mammal is Hadrocodium wui (which dates 195 million years ago). Ancient mammals around this time evolved into three kinds 180 million years ago:
Marsupials (e.g. Kangaroos); the Monotremes (e.g. duck-billed platypus); and the Placentals (majority of all mammals today). By 120 million years ago a group of placentals evolve into ancestors of insectivores mammals and rodents, then 100 million years ago,
a group of placentals called the Archonta (Euarchonta) evolve as the ancestors of Scandentia (the tree shrews) AND the ancestors of Plesiadapiformes (with primate characteristics). Purgatorius ceretops only evolves from ancient Plesiadapiformes about 67 million years ago.
Animal Armageddon: Purgatorius This 40 seconds TV documentary is on YouTube.
Click on link. The full 1 hour episode is on
Amazon DVDs (look for Animal Armageddon Episode 4).
Animal Armageddon Episode 4 Animal Armageddon Episode 4 covers Purgatorius. The story of how
Purgatorius survived the huge asteroid impact begins from 5 minutes of this Youtube compilation, however watch it from the beginning to understand it better.
Copyright prehistoricanimal.blogspot.co.uk. In the diagram above that explains human evolution to teens,
T-Rex is seen advising the tiny Purgatorius to runaway from the asteroids debris and hide!
NEW UPDATED DATA
An article in the respected British science journal Nature
pushed further back in time, the ancestor of primates existed, further making this topic confusing. In the April 18th 2002
edition of the journal, researchers at the Field Museum of Chicago led by Dr Robert D. Martin, using statistical analysis and data from
all early primates from 67 million years ago, postulate that the earliest origin of primates must be pushed back
from 67 million years ago (Purgatorius) to 85 million years ago, millions of years before the dinosaurs became extinct, but around the time the dinosaurs were alive and kicking!
This 85-million-year-old early common ancestor of the primates was the size of rats. However no fossils of this
85 million year old primate ancestor has been uncovered and so Purgatorius currently holds the crown as the
oldest possible primate.
2002 National Geographic
reports that a new study supports idea that primates and the dinosaurs did coexist
EOCENE EPOCH ARRIVES
It is during the Eocene epoch, 56 to 34 million years ago which
provided the most important primitive primate-like
mammal species or Euprimates (primitive prosimians), that excites scientists. In June 2013
BBC Science reported that a 55 million year old Eocene epoch fossil of a primitive primate, the size of rats, had been discovered in China. It was given the name
Archicebus. It is possible that a much older Eocene epoch fossil than Archicebus,
will one day be uncovered, but for the time being, Archicebus remains the
oldest evidence of Eocene epoch primitive primates today.
From the book Primate Evolution and Human Origins edited by John G. Fleagle, Aldine Transaction, 1987,
we learn that the extinct Eocene epoch primates are divided into Adapids and Omomyids,
(both were extinct primitive Eocene epoch Prosimians that descend from Purgatorius).
Adapids (first discovered by 18th century French zoologist, Georges Cuvier) is the name given to all extinct primitive primates (primitive Prosimians)
that primarily evolved in the
Eocene epoch between about 52 to 47 million years ago, (family Adapidae).
Adapids also known as Adapiformes, evolved into the wet-nose primates (or Strepsirhines)
and are the ancestors of
today's modern Prosimians such as lemurs and galagos / bush-babies (only found in Madagascar),
pottos and lorises.
Omomyids or Haplorhines or dry-nose primates (family Omomyidae), are the other
notable extinct Eocene (but more advanced) primitive
primates. They evolved 50 to 45 million years ago. They are the ancestors of today's tarsiers (a more advanced type modern Prosimian) and all the Anthropoids (today's monkeys, apes and humans).
Did You Know That?
One major difference between dry-nose primates and wet-nose primates, is that wet-nose primates have a
fantastic sense of smell. If you ever wondered how a grizzly bear or polar bear can smell blood or its prey over a mile away, it is because
bears are wet-nose mammals. The same reason sniffer dogs are used for finding tiny amounts of
drugs at airports or by police for tracking the scent of
humans is because
dogs are also wet-nose mammals. The noses of wet-nose mammals are always watery in appearance,
which helps give them massive sense of smell or olfaction that is over 500 times as powerful as the human sense of smell.
Given its age, scientists place Archicebus as the ancestor of all Omomyids.
N.B. some primate biologists suggest Omomyids are cousins and not ancestors of Anthropoids.
Archicebus would later evolve into Darwinus Masillae or Ida 47 million years,
who was the direct ancestor of all Anthropoids (monkeys, apes and humans). More information on Darwinus Masillae is given below.
Where does Archicebus fit in the primate evolutionary tree?
The link below is the June 2013 science report on the 55 million year old Eocene epoch primate fossil (Archicebus)
was discovered in China.
Dr Clark Spencer Larsen in his book Our Origins: Discovering Physical Anthropology, published in 2011, makes things a bit complicated,
by indicating that all the Anthropoids (monkeys, apes and humans) did not descend from Omomyids, but from
Eocene primates known as Basal Anthropoids.
This was due the discovery in China in 1999 of a Basal Anthropoid species known as Eosimias (also called the Dawn Monkey), which looked a lot like a primitive Anthropoid but was more advanced than the Omomyids.
Theory is that 50 million years ago Eosimias (which probably evolved from
the ancestors of Omomyids or Haplorhines), evolved into the ancestors of the Anthropoids via Darwinus Masillae (Ida).
So the debate rages: Did today's Anthropoids evolve from Eosimias or did they evolve from Omomyids?
Dr Rasmussen, is one of several primate biologists who did extensive research work on
the evolution of Adapids and Omomyids
and appearance of Anthropoids. Incidentally however, he theorises that both Adapids and Omomyids are ancestors of the Anthropoids,
and not just the Omomyids alone.
Source: D. Tab Rasmussen, Anthropoid Origins: a possible solution to the Adapidae - Omomyidae paradox, Journal of Human Evolution,
1986, 15(1)1-12. This interesting research paper reveals reasons for his theories.
One thing is pretty clear though: Either Eosimias or Omomyids (Archicebus), which were both extinct Prosimians,
evolved into Darwinus Masillae 47 million years ago (the closest
in the evolutionary line where prosimians branched into today's Prosimians and into today's Anthropoids or Simians (humans, apes and monkeys).
One notable Eocene Omomyids is Teilhardina brandt, which lived 53 million years ago. Scientists say this primitive primate had the
oldest known nails in any primate (all modern primates have nails, instead of crawls found in other mammals like bears). Human nails on the fingers and toes all trace back to this primate,
while nails have no important function to humans other than uses like peeling an orange or self defence to scratch a person, they were very essential to other primates e.g. as finger pads that allow for sensitive touch and the ability to grasp.
(Source: Teilhardina brand American Journal of Physical Anthropology, Volume 146, Issue 2, pages 281–305, October 2011).
RECAP
To recap so far: primates are mammals that are divided into Prosimians
(including aye-aye, bushbabies, lemurs, lorises,
galagos and tarsiers) and Simians also known as
Anthropoids or higher primates (i.e. humans, apes and monkeys). Humans evolved from an ancestor of modern apes and monkeys. Today there are 250 different modern primate
species. During evolution, Prosimians obviously appeared first before Simians. There was a point in time when
no Simians existed at all, just Prosimians. Later on in time one type of ancient primitive
prosimian (which descended from the Omomyids or Haplorhines ), such as Darwinus Masillae or Ida 47 million years ago split off
from the evolutionary line to develop into Simians (humans, apes and monkeys).
Darwinus species was named in commemoration of the bicentenary of the birth of Charles Darwin.
The Hunt for the Dawn Monkey: Unearthing the Origins of Monkeys, Apes, and Humans by
Chris Beard explains how 47 to 45 million years ago, an ancestor of humans, apes and monkeys
emerged from Prosimians. The Link: Uncovering our Earliest Ancestor by Colin Tudge
adds a much more detailed explanation on what happened 47-45 million years ago with the arrival of
the Dawn Monkey.
THE ANCESTORS OF APES AND HUMANS SOON SPLIT FROM THE ANCESTORS OF MONKEYS
So far we have
read about how the ancestors of prosimians split from the ancestors of monkeys, apes and humans about 47 million years ago via Darwinus.
Now evolution is set to initiate an important
split between the ancestors of monkeys on one side and the ancestors of humans and apes on the other side. This took place roughly 25 million years ago.
There was a point in time 46 to 26 million years ago
when no ancestors of ancient apes and humans existed at all, just ancient prosimians.
Monkeys (i.e. Old World and New World Monkeys monkeys) such as baboons were the first to
evolve from
Prosimians about 30 million years ago.
Later in time a common ancestor of ancient apes and humans,
split off from the main evolutionary line of ancient monkeys to develop into
the ancestors of apes and humans today. Primitive
anthropoid groups that existed before the primitive ancestors of ancient
apes and humans existed, included, groups such as
Piliopithecids,
Parapithecids and Propiliopithecids. The Primitive
anthropoid group known as Propiliopithecids represents
closest point in the primate evolutionary tree when a big split between the ancestors of ancient apes and humans
one one side and the ancestors of ancient
monkeys one the other side occurred.
Today most scientists agree that Aegyptopithecus was the best known propliopithecid.
The famous Aegyptopithecus fossil was discovered by Dr Elwyn Simons (Duke University primatologist) in 1965 in the
Jebel Qatrani Formation in the Fayum Province of Egypt.
The location of Proconsul africanus (23 million years ago) in the primate evolutionary family tree
Proconsul africanus is believed to have evolved into several now extinct species, including the precursors of humans, known as
the hominids such as the Australopithecines and the Ardipithecines (to be discussed later on). A lot of scientists prefer to use the term "hominin" instead of hominid.
They both mean the same thing: early human ancestors.
About 19 million years ago
a common ancestor (which descended from Proconsul africanus) of humans (genus Homo); gorillas and chimpanzees (genus Gorilla and Pan); gibbons /siamangs (Hylobates) and
orang-utans (Pongo) existed.
The so
called “missing link” is a mystery time in the past when apes evolved to come
down from the trees and live life exclusively on land.
RECAP
To recap so far in this ebook about human origins, we first encountered the Therapsid reptiles.
The very first Prehistoric mammals evolved from the Therapsid reptiles about 210 million years ago, e.g. as seen in Tritheledonts fossils.
Tritheledonts or Ichthyosaurs fossils dates 200 million years ago during the Jurassic period. They are the best examples of ancient reptiles (in evolutionary transition) with mammal features. These ancient reptiles were the ones that evolved into mammals. Our journey continued with these fascinating extinct creatures:
A) Hadrocodium wui, the earliest and possibly the best example of the very first prehistoric mammal
(from 195 million years ago); onto
B) Archonta, a specific group of ancient mammals (100 million years ago),
which broke away from the rest of the early mammals to evolve into the ancestors of the Plesiadapiforms; we then moved onto
C) Purgatorius which was the first primitive Plesiadapiform AND the earliest verified primate
(67 million years ago or Cretaceous period); then onto
D) Archicebus, the oldest Eocene epoch prosimian primate (55 million years ago);
then onto
E) Adapids and Omomyids, (50 million years ago), who are our closest prosimian ancestors,
then onto
F) Darwinus Masillae or Ida which heralds the arrival of the Anthropoids who split from
the prosimian lineage (47 million years ago), then onto Propiliopithecids such as Aegyptopithecus
(29 million years ago, the common ancestor before ancient
monkey lineage split from ancient humans and apes lineage
then finally onto
G) Proconsul africanus, the oldest direct ancestor of all the primitive hominids (prehistoric ancient humans) and the prehistoric great
and lesser apes (23 million years ago or Miocene epoch).
Soon we will come across the best candidate for the so-called missing link of the
ancestors of prehistoric humans and prehistoric great apes (gorillas and chimpanzees):
Kenyapithecus wickeri 14 million years ago or Pierolapithecus catalaunicus 13 million years ago.
From there we will journey to the very start of the very first ancient human-like species from 7 million years ago:
the hominids, during the Pliocene epoch. A lot of scientists prefer to use the term "hominin" instead of hominid.
They both mean the same thing: early human ancestors.
But why on earth are humans classified as primates? What's the logic for this classification?
As noted earlier on: primates are mammals that are divided into Prosimians (including aye-aye, bush-babies or galagos, lemurs (these first three only found in Madagascar), lorises, pottos, and tarsiers) and Simians also known as Anthropoids or higher primates (i.e. humans, apes and monkeys).
Examples of the different types of primates.
From Encyclopedia Britannica: The order of mammals known primates, with its 300 or more species, is the third most diverse order of mammals, after rodents (Rodentia) and bats (Chiroptera).
They share several anatomic and functional characteristics reflective of their common ancestry 65 million years ago to Purgatorius.
When compared with body weight, the primate brain is larger than that of other terrestrial mammals.
Whereas all other mammals have claws or hooves on their digits, only primates have flat nails.
Primates have the most distinct feature: opposable thumb, giving primates the capability of grasping objects
with their hands and some cases feet as well. Another distinct feature is that unlike most mammals,
primates have color vision.
Members of the order Primates are the only mammals that show a remarkable range of size and adaptive diversity. The smallest
primate is Madame Berthe’s mouse lemur (Microcebus berthae) of Madagascar, which weighs some 35 grams
(one ounce); the most massive primate is certainly the male gorilla, whose weight may be more than 4,000 times as great,
varying from 150 to 210 kg (about 310 to 500 pounds). There are famous humans whose weight was in excess of 400 pounds such as the WWE wrestlers, Big Show, Mark Henry, Yokozuna, Big Daddy V and Andre The Giant, but
about 87% of humans today weigh below 300 pounds. 98% of healthy adult male gorrillas are over 300 pounds!
Finally primates are the only mammals that have species that do not have
tails. Modern orang-utans, gorillas, chimpanzees and modern humans all lack tails.
These primates lost their tails just after 25 million years ago, when the ancestors of apes and humans diverged
from a common ancestor (i.e. Darwinus Masillae species) with other primates such as prosimians and monkeys. The most common
ancestor after the divergence and the disappearance of tails was Proconsul africanus species (dating 23 million years ago).
It is thus important to understand and remember, that humans ARE not descended from ancient chimpanzees
or from ancestors any other modern ape. Rather, modern apes and humans are
descended from a more primitive anthropoid ancestor Proconsul Africanus.
HUMANS AND THE HOMININAE SUBFAMILY
Humans
descended from a specific group of primates biologists call
the Homininae subfamily.
Lets recap so far: Primates (an Order of mammals)
are divided into 3 subgroups or Infraorders:
1) Infraorder Lemuriformes or primitive Prosimians (including aye-aye, bushbabies, lemurs, lorises, galagos, and pottos). Suborder Strepsirrhini, or wet-nose primates. Descended from ancient Adapids.
2) Infraorder Tarsiiformes or advanced Prosimians (The Tarsiers). Suborder Haplorhini or dry-nose primates. Descended from ancient Omomyids.
3) Infraorder Simiiformes or Anthropoidea (or the Anthropoids or higher primates such as humans, apes and monkeys). Suborder Haplorhini or dry-nose primates. Descended from ancient Omomyids.
The anthropoids themselves (Infraorder Simiiformes) are divided into two mains parts or parvorders known as:
Platyrrhini (New World Monkeys, found only in central and South America (such as marmosets and tamarins) AND
Catarrhini (Old World Monkeys (such as baboons), Apes, Humans, all found worldwide).
The Catarrhini parvorder are then further divided into two main superfamilies:
Hominoidea (apes and humans)
and Cercopithecidea (Old World monkeys).
When biologists want to study the evolution of primitive humans before 23 million years ago,
they need to study two extinct superfamilies of the Catarrhini parvorder (fossils have been found)
that are related
to the Hominoidea superfamily.
These two extinct superfamilies: Propliopithecoidea and Saadanioidea (both anthropoid hybrids) plus the Hominoidea (Apes and Humans)
and Cercopithecidea (Old World monkeys)
superfamilies make up the main part of anthropoids (i.e. Old World monkeys, apes and humans).
1. Extinct Propliopithecoidea superfamily: includes extinct hybrid
anthropoid species
such as Propliopithecus and Aegyptopithecus discussed earlier on. They all evolved 34 to 40 million years ago from ancient primitive Prosimians
or the Lemuriformes, described above.
2. Extinct Saadanioidea superfamily: includes the famous extinct ancient primitive
anthropoid
species known as Saadanius hijazensis discovered in Saudi Arabia. It evolved 29 million years ago from
the Propliopithecoidea superfamily, which as noted earlier on represents closest point in the
primate evolutionary
tree when a split occurred, causing the ancestors of ancient ancient humans and apes
to split from the ancestors of monkeys. When this split occurred, two new surviving superfamilies
were created: Cercopithecidea (Old World Monkeys) and Hominoidea (Humans and Apes).
3. Cercopithecidea superfamily: contains all modern Old World monkeys such as baboons, macaques
rhesus, mangabeys, mandrills, guenons, patas monkeys, langurs, proboscis monkeys, colubus etc. Their ancestors all evolved from the Saadanioidea superfamily 28 to 25 million years ago.
Because Proconsul africanus had a mixture of Old World monkey and ape characteristics, placement in the ape and human superfamily Hominoidea is tentative. So biologists place Proconsul africanus in a new superfamily called Proconsulidea.
4. Hominoidea superfamily includes all modern apes and humans. Their ancestors all evolved from the Saadanioidea superfamily roughly 25 million years ago, leading up to
the arrival of Proconsul africanus (the main ancestor of modern apes and humans) 23 million years ago.
From 22 million years ago, Proconsul africanus (from the Proconsulidea superfamily) evolves into a common ancestor (a.k.a. missing link) of humans (genus Homo), gorillas (genus Gorilla), chimpanzees (genus Pan), gibbons / siamangs (genus Hylobates) and orang-utans (genus Pongo).
Humans, alongside gorillas and chimpanzees (we recall are known as members of the great apes),
also share their own common ancestor as well (another missing link scenario).
Candidates for the missing link of the humans and the great apes include species such
as Kenyapithecus wickeri 14 million years ago or Pierolapithecus catalaunicus 13 million
years ago.
You can read more about primates in general in Professor Emeritus Robert Jurmain's books on anthropology such as
the 14th edition of Introduction to Physical Anthropology by
Robert Jurmain, Lynn Kilgore, Wenda Trevathen and Russell L Ciochon, published by Cengage Learning
in 2013. It is a runaway favourite among university students and lecturers worldwide. ISBN-13: 978-1285062051.
19 million years ago, a common ancestor (via Proconsul africanus)
of humans (genus Homo); gorillas and chimpanzees (genus Gorilla and Pan); gibbons /siamangs (Hylobates) and orang-utans (Pongo) existed, then one day nature
decided to do something rather extra-ordinary, the common ancestor via evolution, gradually over time began to diverge or split into 5 brand new species:
today's humans, chimpanzees, gorillas, gibbons and orang-utans.
Ancestors of gibbons /siamangs
and orang-utans split first. So when exactly
did the ancestors of gibbons / siamangs and orang-utans evolve away from the ancestors of
the great apes (chimpanzees and gorillas) and humans?
Molecular
DNA and fossil evidence indicates that the ancestry of gibbons became distinct from great
apes and humans 18 million
years ago . This means that between 19 to 23 million years ago, the ancestors of
the gibbons had not yet split
from Proconsul africanus species.
Meanwhile orang-utans became distinct from the great apes and humans
at about 13 million years.
Around 10 million years ago, a descendant of Pierolapithecus catalaunicus (species not yet named) underwent
an important evolutionary changes in brain size.
Molecular geneticists discovered a
mutation in the gene known as RNF213 caused more blood to flow to the brain, increasing the sizes of the brain in relative size to the body.
What triggered this mutation is currently unknown. A big brain is the major characteristic of genus Homo, though the actual size may vary. Homo habilis has the smallest and Neanderthals had the largest, modern human brains take second place.
Molecular geneticists have identified two important genes whose mutations caused Homo erectus species to develop larger brain sizes: after the human line
split from the chimpanzee lineage 7 million years ago, two genes that mutated were identified as SLC2A1 and SLC2A4. Both triggering bigger brain sizes in the Ardipithecines and Australopithecines.
In Homo erectus species the genes underwent much further mutations.
These two gene mutations both build proteins that transport glucose in and out of cells. The gene tweaks (via evolution)
took glucose away from muscles and into the early hominid brains. The glucose would then have boosted the brains, allowing them to grow bigger. Homo erectus species
got a big boost in brain sizes when they began to eat raw meat. Ardipithecines and Australopithecines did not eat meat so did not get the extra boost in brain sizes, but SLC2A1 and SLC2A4 did begin with the arrival of
the Ardipithecines and Australopithecines!
You will read more about our ancient human ancestors: Homo erectus; Homo habilis ; the Neanderthals; as well as
the Ardipithecines and Australopithecines, later on in this scientific HTML eBook.
A BBC Science report
calls Pierolapithecus catalaunicus species the “original great ape”.
Even
though on the outside humans look different from gorillas and chimpanzees,
humans share at least 96% of their DNA with chimpanzees and
gorillas. Meanwhile human DNA is approximately 98% identical to that of
chimpanzee DNA. Yes that close!
Jeremy Taylor in his fascinating book Not a Chimp: The Hunt to Find Genes that Make US Human and
What It Means to be 98% Chimpanzee: Apes, Peoples and the Genes by Jonathan Marks,
both suggest just 2% of total genes in human genome (the sum total of 70,000 genes
in our 46 chromosomes) is what makes us
different genetically from chimpanzees. Another important text in this area is Almost Chimpanzee:
Redrawing the Lines That Separate Us from Them by John Cohen
2% is a very huge number in genetics. Genes mainly code for proteins (enzymes, hormones etc).
But many genes do not code for anything at all. The $2.7 billion Human Genome Project (completed in 2003), tells us that
the human genome has about 70,000 odd genes,
of which about 30,000 genes are protein-coding genes. However the non-coding genes (including HARs) are still
important because many of them control (e.g. activate or inactivate) protein-coding genes, and thus both coding and non-coding genes are studied equally to fully get a picture of how different genes work.
Chimpanzee genome has been sequenced in great detail as well (completed in 2005), so that is how we found out that humans share at least
98% of their DNA with chimpanzees!
The current conservative estimate is that about
10 percent of the human genome has undergone positive selections since modern humans
emerged about 200,000 to 300,000 years ago. Scientists estimate that it takes about 200 generations
for a specific “natural selection” to emerge from a mutation and spread to a wide enough
population to reveal itself. For instance lactose tolerance was a mutation that occurred once
so many Eurasians adults began drinking milk in large numbers circa 5,000 BC (once diary
farming was in full swing, following the invention of agriculture circa 12,000 BC). But lactose
tolerance did not evolve quickly initially. Rather it took
about 200 generations for natural selection to manifest itself and allow the very first true
lactose tolerance adults to appear.
2% of 70,000 genes is 1,400 genes. We are different from chimpanzees due to 1,400 genes in our DNA. 1,400 genes may not seem a lot, but it equates to more than
30 million point mutations, or over 30 million single nucleotide differences. We will discuss DNA, mutations and nucleotide polymorphisms later on at Section E.
Positive selections in the human genome that caused it to evolve differently from chimpanzee DNA
took place over a much longer period compared to the “positive selections” that led to lactose tolerance.
Not 200 generations, but about 7 million years. Put in another way, it took about 7 million years,
via evolution and natural selection for
enough mutations to build up in the human genome and cause 1,400 genes to be very different from chimpanzee DNA, equating to more than
30 million point mutations, bearing in mind
that 7 million years ago both humans and chimpanzees had a common ancestor, who had just one fixed identical genome!
There are some fascinating texts that take a detailed look at the how the human genome evolved over 7 million years,
once it diverged from the common ancestor with chimpanzees. Three such enjoyable books are Ancestors in Our Genome: The New Science of Human Evolution
by Eugene E Harris. It was published in 2015, so it is an updated text. The next is Principles of Human Evolution,
by Roger Lewin and Robert A Foley. Finally The Origins of Modern Humans: Biology Reconsidered by Fred H. Smith and James C. M. Ahern explores
how biology, genetics and paleoanthropology have combined to help us understand human evolution following the divergence 7 million years ago.
The Telomere Mystery in Humans
We now look a few major genetical differences that have built up in the genomes of humans and chimpanzees over 7 million years. While humans have 23 pairs of chromosomes (i.e. 46 chromosomes)
chimpanzees have 24 pairs or 48 chromosomes. Human ancestors started out too with 48 chromosomes
but during human evolution from 4 million years ago, one pair fused together to leave just 46 chromosomes today. Also at the end of each chromosome
is a string of repeating DNA sequences called telomeres, they are protective caps on the ends of chromosomes.
Chimpanzees and other great apes like gorillas
have about 23 kilobases (a kilobase is 1,000 base pairs of DNA) of repeats.
Humans are unique among primates with much shorter telomeres only 10 kilobases long. A telomere itself is an
amazing structure: telomeres lose a bit of their DNA every time a cell divides.
Eventually, when all of the telomere DNA is gone, the cell cannot replicate anymore and becomes dormant.
White blood cells and some other cell types with the capacity to divide very frequently
have a special enzyme known as telomerase, that prevents their chromosomes from losing their telomeres.
So because white blood cells can retain their telomeres, they generally live much longer than other cells.
Other cells like red blood cells do not express the telomerase gene, so do not have the enzyme and hence do not survive long in the human body once produced.
Telomeres also play a an important role in cancer, because the chromosomes of malignant (cancer) cells
usually do not lose their telomeres, helping to fuel the uncontrolled growth of cells.
Therefore the telomerase enzyme in cancer cells rescues cancer cells from destruction by
extending the life span of their telomeres. Hence the Telomerase is somewhat over-expressed in many advanced cancers,
but assessing its potential as a therapeutic target requires us to understand what it does and how it does it. One way cancer drugs
could work is to make drugs that only target cancer cells telomerase enzyme and make the cancer cells loose all their telomeres
and in sense soon stop growing. Research is still ongoing
to develop drugs that can do this, as it is currently extremely hard to only
target telomerase enzymes in cancer cells without damaging healthy white blood cells telomerase. For discovering how human chromosomes are protected by telomeres and
the enzyme telomerase, Drs Elizabeth H Blackburn, Jack W Szostak and Carol W Greider were awarded the 2009
Nobel Prize in Medicine. Drs Greider and Blackburn jointly
discovered the telomerase enzyme back in 1984.
The FOXP2 Gene and Other Unique Genes in Humans
One good example of 2% (i.e. one of the 1,400 genes) is the all important FOXP2 gene in humans, which evolved more rapidly than the one in chimpanzees and is much more advanced and specialized. The mutation in the human FOXP2 gene found in brain cells is what gives humans the ability to speak different languages, other primates have an undeveloped FOXP2 gene allowing only shouting, wailing and growling sounds and not full speech.
According to Wikipedia, the protein coded by the FOXP2 gene in humans and chimpanzees differs (via mutation) by the substitution of just two amino acids, threonine to asparagine substitution at position 303 (T303N) and asparagine to serine substitution at position 325 (N325SA) on the human genome.
Another difference is the work of the ASPM gene and the MCPH1 gene. Small changes in the ASPM gene was the cause of the big difference in brain size between humans and chimps. Meanwhile the MCPH1 gene (called Microcephalin) which controls the start of brain size development in foetuses, was expressed early, explaining why human babies have bigger brain sizes than baby chimps. Both genes are what caused humans to have much bigger brain sizes in adulthood compared to chimpanzees.
Yet another difference is the gene controlling for muscle and bone growth which makes humans much taller and bigger in size than chimpanzees.
However one important fact: An adult male chimpanzee is much stronger than 2 adult male humans, pound for pound, due to the way
the skeletal muscles and bones in the shoulders and arms have evolved in both primates.
Chimpanzees have been shown lifting two 90kg (or 198 pounds in weight) weights in each hands with ease! This is possible because professional body builders,
professional body guards, professional boxers and professional wrestlers can only use about 30% of the physics of the muscle force in their arms and shoulders.
Evolution restricts all human males to 30%. Whereas chimpanzee can use a full 100% of the physics of the muscle force in their arms and shoulders.
So no matter how much gym work humans do (with or without anabolic steroids), we only use about 30% of the physics of the muscle force. Put simply,
humans do not have full unrestricted control over their muscles. A good example of comparing the
physics of the muscle force is seen in the massive extraordinary bite force of Great White Sharks
and Salt-Water Crocodiles: the physics of the bite force translates as the equivalent of 500 kg or more
in weight! which is about just over 1,000 pounds in weight. However it is easy for humans to hold down
crocodile's mouth when it is shut! or use duct tape, because a crocodiles cannot use 100% of the physics of the muscle force in their mouths,
to open it when it is shut!
The Smithsonian Institution Explains Why Chimps Are Much Stronger
Than Humans
Meanwhile the genes controlling excessive thick hair growth on the body other than the head
in humans is switched off (has been deactivated over 1 million years ago), so humans have no body furs
compared to chimpanzees. In the absence of furs, humans have just thin hairs on the body, in particular males
on the chest, legs and arms. However there is one major difference: the hair on human heads and the beard on human males grows forever,
meaning all humans will need a hair cut after several weeks and a beard shave after several days.
This is the exact opposite to chimpanzees as they will never need a hair cut in their lifetime!!
The EDA gene is what controls how much fur a mammal has. The Human EDA gene is switched off during the late embryo stage,
but the gene is fully active on skin cells on the head of embryos, so we are born with no furs, but later on we develop a nice "fur" on the head.
Also a mutation in the human gene called KRTHAP1 that codes for keratin (the essential protein that makes human hair structure) caused
the thinning of all remaining human body hair, except on the head! People with too much body hair have a genetic defect in the KRTHAP1 gene.
Diagram above shows a few of the 1400 genes (2% of the Human genome) that makes humans different from chimpanzees at a genetic level. HAR1 and HAR2 shown in
diagram above, are not exactly genes so to speak, but rather gene enhancers. More of this explained below.
NEW UPDATED DATA
After the complete chimpanzee genome was decoded back in 2005 (two years after the human genome was completely decoded), scientists discovered something amazing.
When the human genome was decoded, scientists discovered that there are certain regions in the human genome that evolved very fast.
They are called HAR or Human Accelerated Regions. Chimpanzee genome did not reveal any similar regions in their genome related to
Human Accelerated Regions, meaning that during human evoluton after diversion 7 million years ago, something triggered parts of the human genome to evolve faster that other parts. This explains several
amazing things humans can do that chimps just can't, such as speaking distinct languages, typing fast and writing.
The vast majority of HARs are not actually genes in the normal sense, but a tiny few HARs are genes. About 430 HARs have been identified, and they
are very small in nucleotide base pair lenght,
just an average 280 nucleotide base pairs,
making them much smaller than the smallest gene in the human genome ( the smallest gene in the human genome is histone gene),
which is only 500 nucleotide base pairs in size. One amazing HAR is called HAR2 (shown in the diagram above). Although HAR2 (also knonw as HACNS1) is not a gene (i.e. it
does not code for a particular protein)
HAR2 is known function as an Enhancer.
In the human genetics, an Enhancer is a DNA sequence that works to increase or decrease the level of gene expression,
(the ability of genes to make proteins is called gene expression, discussed in detail in SECTION E). Put in another way, enhancers regulate gene expression.
A gene will become activated when it gets close to an Enhancer. It is believed that HAR2 increased the activity of genes that make the bones in human fingers so flexible in grasping objects.
When you watch a chimpanzee grasp a straw, you will see it is very childish compared to the way humans grasp a straw. It is this enhacement that also allowed
humans to be able to write beautifuly on a paper. The genes in chimpanzees that make the fingers had no such enhancements,
meaning chimpanzees will never be able to write as humans do, save for childish scribbles! Using tools like fork and spoon or creating tools is yet another beneficial way human HAR2 works.
HARs are believed to have increased the activity of the ASPM and MCPH1 genes (discussed ealier on and in more detail at the section on Homo erectus), which made human brains to grow much bigger in size than chimpanzee brains.
One particular HAR believed to have influenced the genes that made brain sizes in humans to increase is HAR5 (also known as ANC516). Another particular
enhancer is believed to have increased the gene expression of the FOXP2 gene in humans,
explaining why this enhancement made humans be able to speak different languages, which chimpamzees just can't.
The Sialic Acid and Siglec 5 Mystery in Humans
Finally another genetic difference worth mentioning is the mysterious Sialic acid absence in humans. Sialic acids
is the biochemical name given to a complex group of unique sugar molecules found on the outer surfaces of all human and animal cells, as well as plant, bacterial and fungi cells. Even insects need em! Sialic acids alongside glycans play an important role in cell-to-cell communication: serving as binding sites for receptors.
Thus a human cell can communicate with another human cell by binding onto the Sialic acid receptor site of cell it wants to "talk to".
The pathogens that cause diseases like malaria (Plasmodia protozoa), cholera (bacteria) and influenza (viruses) also use the
Sialic acid receptor site of the human cell it binds to, causing the disease. Cancer cells also use
Sialic acid receptor sites when they spread cancer to new cells in the human body. This is possible because sialic acids act like night club bouncers at the door and they decide what chemical messengers are allowed to go in and out. But this system of guarding the outer surface of cells can be abused by pathogens, like viruses, which have evolved the ability to attach to the sialic acids / glycans as a first step to invading cells, infecting them, and causing disease.
Two prominent forms of Sialic acids are found in most living cells:
N-acetyl-neuraminic acid (Neu5Ac)
and N-glycolyl-neuraminic acid (Neu5Gc). During human evolution 3 million years ago (when the Australopithecines like Lucy existed, to be discussed later in this HTML eBook at Section B) humans somehow lost the ability to make
Neu5Gc, (the
human Neu5Gc gene underwent a mutation and did not express the enzymes that makes Neu5Gc). However chimpanzees and other primates
retain the ability to make Neu5Gc. Humans are only primates that lack Neu5Gc. Scientists have calculated that early human ancestors from 6 million years ago did make Neu5Gc, but around 3 million years ago all human ancestors from Homo erectus stopped making Neu5Gc. However scientists
say Neu5Gc is made in humans in embryonic and cancerous cells. But there is flip-side:
chimpanzees and the other great apes, have very high levels
of Neu5Gc in all tissues, except, interestingly, in their brains, where the concentration of Neu5Gc is much lower. However, by failing to make any Neu5Gc whatsoever, humans have no Neu5Gc in their brains at all. Scientists have a feeling this difference
between low levels and complete absence of Neu5Gc in the brain might have proved crucial for the rapid
human brain evolution that made humans go on to have bigger brain sizes than chimps.
With two prominent forms of Sialic acids, we thus have two types of pathogens: Neu5Gc-binding pathogens that like to communicate with cells that have Neu5Gc receptor on the surface, and
Neu5Ac-binding pathogens that like to communicate with cells that have Neu5Ac receptor on the surface.
Biochemists such as Professor Ajit Varki (professor of glycobiology at the University of
California, San Diego) discovered in 1998 and later in 2001 that
Neu5Gc appears to confer protection to cancer and several diseases
like human malaria, cholera, Alzheimer's disease, rheumatoid arthritis, bronchial asthma and influenza among others. Hence chimpanzees do not
develop several types of cancers commonly found in humans
and chimpanzees do not get human malaria, Alzheimer's disease, schizophrenia, autism
cholera, atherosclerosis, bronchial asthma, influenza and certain cancers etc due to the fact that they have Neu5Gc. In addition to this, scientists say that
chimps CD4+ T-cells (so-called helper T-cells) are very rich in Siglec 5 which is absent in human helper T-cells, and Siglec 5 is believed to protect
chimps from
chronic active hepatitis, inflammatory bowel disease, rheumatoid arthritis, type 1 diabetes, multiple sclerosis and psoriasis. Siglecs (which stand for sialic acid recognising lectins) are part of a huge family of antibodies called immunoglobulins.
T-cells or T-lymphocytes are types of white blood cells produced by the thymus gland in human necks and actively participating in the immune response.
Siglec 5 belongs to a group of siglecs, biochemist call CD33rSiglecs. To this day, biochemists still do not understand
why CD33rSiglecs such as Siglec 5 are mysteriously absent on the surfaceof human CD4+ T-cells. But lots of clues do point to the abundance of Neu5Ac in humans. Some how evolution figured out that mammals with only Neu5Ac (i.e humans) do not need CD33rSiglecs!! But evolution is not perfect, the absence of Siglec 5 in humans means humans are more prone to diseases involving T-cell activation, such as chronic active hepatitis, inflammatory bowel disease, rheumatoid arthritis, type 1 diabetes, multiple sclerosis, bronchial asthma, and psoriasis etc.
Source: Loss of Siglec expression on T-lymphocytes during human evolution
Proceedings of The National Academy of Science, 2006 May 16; 103(20): 7765–7770. The authors of the science article are:
Dzung H. Nguyen, Nancy Hurtado-Ziola, Pascal Gagneux, and Ajit Varki.
Given the possible health benefits of both Neu5Gc and Siglec 5 in chimpanzees, unfortunately neither natural or artificial
Siglec 5 or Neu5Gc can be used directly as a therapeutic drug, because it is seen as foreign molecule by the human body and
if Neu5Gc or Siglec 5 is injected into humans, our immune system will attack them instantly, via massive production of cytokines: leading to the dreaded cytokine storm (our immune system goes into massive overkill: shock and awe assault by our immune system on our own healthy cells). The Ebola virus and Spanish Flu virus are examples of foreign biological molecules that once inside humans trigger a massive cytokine storm. By the way, the human T-cell is in a relatively overreactive state, a least partly because of lack of Siglec 5,
expression. This relative overreactivity may also explain why too much T-cell activation easily occurs in humans leading to excessive release of cytokines (i.e. cytokine storm). Chimps rarely get cytokine storms because Siglec 5 weakens the possibility of chimp T-cells becoming overreactive!! When developing experimental drugs that work by stimulating T-cell activation, drugs companies now know that too much T-cell activation can be dangerous since human T-cells are already in a relatively overreactive state and too much T-cell activation will simply lead to cytokine storm. This discovery came to late for volunteers who took TGN1412 experimental drug back in 2006. Apparently while high doses of TGN1412 had no effect on lab dogs and primates, but in very low doses it did trigger a tragic cytokine storm in all volunteers who took TGN1412. Originally the purpose of TGN1412 was to find ways to modulate T-cell activation and thus make to make drugs that can attack autoimmune and other inflammatory diseases, which work via reducing T-cell activation. However there's still an awful lot about human immunology that we don't understand,
to put it mildly, and in trying to modulate T-cell activation, TGN1412 actually fired up excess T-cell activation, this was because the mechanism by which
TGN1412 was supposed to work, actually made TGN1412 itself, a massive T-cell activator in human cells!
However
humans do eat Neu5Gc all the time, because Neu5Gc is found in animal (mammalian) products like meat and pork but not chicken. More
research on chimpanzee Neu5Gc can help cancer and malaria research. Some scientists are trying to find out
what caused humans to be the only primates that lack Neu5Gc, it is a mystery to be solved via genetics and biochemistry.
They do know however that the CMAH gene in primates like chimps makes Neu5Gc, but the human form of CMAH underwent a bad mutation and stopped making Neu5Gc.
Are There Any Medical Benefits of Neu5Gc Scientists Can Exploit?
One possible explanation for the health benefits of Neu5Gc: Professor Ajit Varki has come up with a very good theory.
In the case of malaria we have human malaria caused by Plasmodium falciparum and chimpanzee
malaria caused by a much different protozoan known as
Plasmodium reichenowi. But human malaria is much more dangerous than chimpanzee malaria!!
Chimpanzees cannot get human malaria and humans cannot get chimpanzee malaria. How is it possible? Here is
what Professor Ajit Varki theorized: humans only have Neu5Ac, and do not have Neu5Gc.
Plasmodium reichenowi only likes to
bind to the Sialic acid receptor site of red blood cells that have Neu5Gc, so in this case humans
who do not have Neu5Gc do not get chimpanzee malaria, since Plasmodium reichenowi does not like Neu5Ac, which human red blood cells
have in great quantity. But because chimpanzees have Neu5Gc
they get this form of malaria.
Meanwhile Plasmodium falciparum which causes
human malaria, is the exact opposite: Plasmodium falciparum only likes to bind to the Sialic acid receptor site of red blood cells that have Neu5Ac, so it is a
Neu5Ac-binding pathogen. Since human red blood cells have an
abundance of Neu5Ac, it is easy to see why Plasmodium falciparum causes malaria in humans.
That chimpanzees do not get human malaria is explained by the fact that the presence of more Neu5Gc AND little Neu5Ac on chimpanzee
red blood cells masks the proper mounting of the Plasmodium falciparum onto the chimpanzee red blood cell's Sialic acid receptor site, so chimps do not get human malaria. In a nutshell: Plasmodium falciparum cannot use Neu5Gc (which is more abundant in chimps) as a Trojan horse to get into the red blood cells of chimps.
This theory is just for malaria. Biochemists are still trying to properly understand why chimpanzees do not get other severe types human diseases, such as
types of
cancers, cholera, Alzheimer's disease, rheumatoid arthritis, bronchial asthma and influenza among others. But it is clear that
the absence or indeed the presence of Neu5Gc in human cells is a big factor. Professor Ajit Varki suggests that food such as
red meat have too much Neu5Gc, which the human body immune system hates so much and tries to use inflammation to
remove it from the human body, but this inflammation of human cells with too much Neu5Gc,
maybe a precursor to start cancer cells or other diseases, (recall that cancer cells in humans do make Neu5Gc). Clearly Neu5Gc may no longer be useful as a
drug for humans, since our human ancestors got rid of the gene that makes it, and today our immune system is
hardwired to attack any Neu5Gc it detects in humans, because it only sees Neu5Gc a bad foreign molecule.
Will Neu5Gc Be As Useful The Way Snake Venom Has Helped
Create New Drugs?
Once scientists understand just how Neu5Gc protects chimpanzees from the several diseases listed above,
we can try to synthsize drugs similar to
the biochemical properties of Neu5Gc for use in humans in some way, maybe one day. This draws a good comparison with how
snake venom has actually saved the lives of millions of people worldwide today. Once the biochemical properties of
snake venom was worked out, it has inspired the development of more than 10 different therapeutic drugs
(from drugs that can help blood to clot or help disolve blood clots OR help us better understand how our nerves function, studying snake venoms that are
neurotoxins). Lets look at one fascinating story: venom from the Brazilian Pit Viper.
Back in the 1950s and 1960s
Brazilian pharmacologists Dr Maurício Rocha e Silva and his student Dr Sérgio Ferreira and colleagues
at the University of Săo Paulo in southern Brazil had discovered that
when a person is bitten by a Brazilian Pit Viper, the person collapses
because their blood pressure drops suddenly and drastically. They theorised that there
was something in Pit Viper venom (later identified as bradykinin) that
drastically reduces blood pressure. Being a pharmacologist Dr Rocha e Silva wondered if snake venom could be
useful in controlling high blood pressure of people with hypertension or recovering from strokes.
Once the key pharmacological
components of the venom were isolated from the Brazilian Pit Viper and analysed in the 1970s and early 1980s independently in the U.S. and Europe, most notably
British biochemist Professor John Vane and colleagues at the Royal College of Surgeons in London,
further research soon established just how Pit Viper venom reduced blood pressure in laboratory rats, rabbits and dogs. This lead the discovery of
a whole brand new class of drugs known as ACE Inhibitors or Angiotensin-Converting Enzyme Inhibitors and
their marketing as very useful drugs for controlling high blood pressure from the 1990s.
Brazilian Pit Viper snake venom apparently had a very high dosage of a
natural type of ACE inhibitor known as bradykinin, that caused a bitten person to rapidly loose blood pressure.
ACE inhibitors work by expanding constricted blood vessels, via
preventing the formation of the naturally occurring substance, angiotensin.
When the kidneys detect a decrease in blood pressure, special cells produce
an enzyme called renin, which converts a normal inert protein molecule made by the liver, (called angiotensinogen) into a bioactive chemical that
raises blood pressure naturally in the body.
The protein that the enzyme renin converts the angiotensinogen into
was identified as
angiotensin,
which is what actually raises blood pressure. There are however four different forms of angiotensin, all denoted by Roman numerals, angiotensin I-IV. Angiotensin I does not actually do much work, but it is the conversion to Angiotensin II by angiotensin-converting enzymes (secreted in the lungs)
that does the blood pressure raising.
Drugs can be made in labs to slow down or prevent (or inhibit) renin from converting angiotensinogen
into angiotensin OR slow down or prevent Angiotensin I being converting to Angiotensin II by enzymes (i.e. ACE),
which the Brazilian Pit Viper does in a very good way in small doses. There is one more story left to add to this amazing discovery.
Although the kidneys by itself can raise blood pressure by the amount of renin it produces, there is a hormone that can trigger the kidneys to retain salt in the body, leading to raised blood pressure!
This hormone known as aldosterone is produced by the adrenal glands, which rest atop the kidneys.
But IT IS the kidneys that release (already-made) angiotensin II into the blood that triggers
the adrenal glands to release aldosterone in the first place! Yes, the renin-angiotensin-aldosterone system is one big amazing and confusing
way our bodies control blood pressure!
The very first drug created in a lab that acts like an Angiotensin-Converting Enzyme Inhibitor, i.e. to prevent Angiotensin I conversion to Angiotensin II, (which was based on
the discoveries made in Brazil) has the tongue-twisting name of
2-methyl-3-sulfanylpropanoyl pyrrolidine-2-carboxylic acid!!!!! It's easy to pronounce
name simply is Captopril, and
was put on the market by Bristol-Myers Squibb, a U.S. pharma company.
Today
many millions of people around the world
control their blood pressure with ACE inhibitors like the popular Enalapril, made by U.S. pharma giant Merck and
Lisinopril, made by British-Swedish pharma giant AstraZeneca. Both drugs biochemical structure is based
on Captopril! Thanks to how scientists solved the
mystery of snake venom magic in Brazil, one day, solving the mystery of Neu5Gc
will one day be useful for humans just like bradykinin was.
In 2001, Professor Ajit Varki has since published research papers on his work the genomes of humans and the great apes like chimpanzees.
Source 1: Genetic Differences Between Humans and Great Apes by Ajit Varki and Pascal Gagneux, Molecular Phylogenetics and Evolution, 2001; 18(1):2-13.
Source 2: Comparing the Human and Chimpanzee Genomes: Searching for Needles in a Haystack
by Ajit Varki and Tasha K. Genome Research, 2005; 15:1746-1758.
Source 3: Loss of Siglec expression on T-lymphocytes during human evolution
Proceedings of The National Academy of Science, 2006 May 16; 103(20): 7765–7770. The authors of the science article are:
Dzung H. Nguyen, Nancy Hurtado-Ziola, Pascal Gagneux, and Ajit Varki.
Ever since the entire human genome was decoded back in 2003 (following completion of the expensive $2.7 billion Human Genome Project),
scientists have now identified all the 1400 genes that makes us human. Both Jonathan Marks and Jeremy Taylor books provides fascinating insights on these genes.
Geneticists tell us that humans themselves are 99.9% identical, and differ by just 0.1% in their DNA ( leading to
such diversities such as the human ethnic groups). 0.1% is also a huge number in genetics as well.
0.1 % of 70,000 genes is 70 genes. It is these 70 genes that makes Europeans, Africans and
Asians different from one another in physical appearance, such as skin colour and hair texture. These 70 genes code for features
such as skin colour, hair texture and colour, shape of the nose and other facial features etc.
To recap so far visually:
Copyright © Clark Spencer Larsen, Our Origins: Discovering Physical Anthropology, 2nd edition 2011. W.W Norton & Company.
The above diagram illustrates the very complex primate species divergence (speciation) from prosimians to humans.
Speciation is the evolutionary process by which new biological species arise, and the speciation of
Prosimians to Humans took circa 65 million years to happen.
To summarise: 65 million years ago, only Prosimians existed. Then 40 million years ago
(via evolution and natural selection) the single Prosimian lineage split further into two groups: one group
evolving into today's modern Prosimians and the other into today's modern Simians (anthropoids).
The Simians lineage then went on to split into several independently evolving species.
First New World Monkeys split from the
lineage leading to humans 35 million years ago, next Old World Monkeys split from the
lineage leading to humans 25 million years ago. This particular split 25 million years ago, as noted previously,
starts the very beginning of the difference between evolution of modern monkeys on one side and
modern apes and humans on the other side, such as the disappearance of tails in
modern apes and humans, which are still present in modern monkeys.
Thus the start of the evolution of the ancestors of the Hominoidea superfamily
(modern apes and humans) began 25 million years ago, once it split from the
lineage of the ancestors of the Cercopithecidea superfamily (modern monkeys).
Then the following sequence of speciation of the Hominoidea superfamily, occurred leading up to the evolution of humans: gibbons / siamangs split from the
lineage leading to humans 18 million years ago,
orang-utans split 12 million years ago, gorillas split 7 to 8 million years ago then finally chimpanzees split 6-7 million years ago.
Here is another simply way to analyse the diagram above:
1) Gibbons and Siamangs shared a common ancestor with humans 18 million years ago.
2) Orang-utans shared a common ancestor with humans 12 million years ago.
3) Gorillas shared a common ancestor with humans 7 to 8 million years ago.
4) Chimpanzees shared a common ancestor with humans 6 to 7 million years ago.
In a nutshell: the direct ancestors of modern humans first appeared 6 to 7 million years ago,
while the very earliest ancestors of modern humans appeared about 65 million years ago (i.e via Purgatorius). However
ancestors of modern humans that LOOKED EXACTLY LIKE US, (i.e. anatomically modern humans) only appeared from 200,000 years ago, This is because in-between 200,000 years ago and 7 million years ago our human ancestors looked so different on the outside and were also so different on the inside (i.e. physiologically).
The next section traces the REAL starting point of human evolution from 6 to 7
million years ago to present.
Copyright © Alice Roberts, The Incredible Human Journey, 2010. Bloomsbury Publishing.
Copyright © Myra Salazar.
The Story of Human Evolution There are so many videos on YouTube about Human Evolution. This is one of the best. It is 1 hour 30 minutes long,
so go get some drinks and popcorn before watching it.
The Ardipithecines and the Australopithecines
The first
group of hominids or hominins to appear occurred during the Pliocene epoch (i.e. just before 6 million years ago), and are known as the Ardipithecines and included the following species:
Notice how East Africa (Kenya and Ethiopia)
has yielded three out of the five Ardipithecine species uncovered. Both countries will also yield the majority of the Australopithecines mentioned below.
Detailed look at Ardipithecus ramidus, the most extensively studied ardipithecine (it was first discovered originally in 1994 in Ethiopia, and after 15 years of painstaking research revealed to the world media in October 2009).
BREAKING NEWS: In September 2017, science reports are revealing that hominid
footprints dating almost 6 million years were found on the European island of Crete!! A lot of scientists, including myself,
were left scratching our heads....how is that possible? Lets us examine this amazing report in detail.
About 50 footprints at a site near Trachilos in Crete were found and dated almost 6 million years ago.
That date places them as early hominid footprints – members of the human species after separation from the chimpanzee lineage from 7 million years ago.
In this blog later on at the section on the Australopithecines, I reveal that the oldest hominid footprints discovered anywhere in the world were the ones made by an
Australopithecine species called Lucy.
The footprints made by Lucy, were preserved on the remains of an ancient volcanic eruption at a site in Tanzania called Laetoli.
The world famous Laetoli footprints were made by three members of Lucy's species ( Australopithecus afarensis), 3 million years ago.
It was discovered in 1978 in Laetoli, Tanzania, by Mary Leakey and Paul Abell. They are still the oldest authenticated and undisputed
footprints made by our human ancestors.
The authors of the science report about the discovery of the 50 footprints at a site near Trachilos in Crete, are urging caution and pointed out themselves,
the findings are highly controversial – as they suggest
our human ancestors may have existed in
Crete at the same time as they were evolving in Africa!!
At this stage we all agree additional
studies are needed before we can know for sure they are indeed evidence of hominids that were part of our ancient human family. Also keep in mind, the
discoveries are footptints and not fossils.
Only if 4, 5 or 6 millon year old homind fossils are discovered in Europe, should scientists
consider the possibility, however remotely, that our ancient homind species were evolving in Europe and Africa at the same time!
Further reading:
1
Ancient footprints in Crete challenge theory of human evolution – but what actually made them? The Independent newspaper, 02 September 2017.
2
Footprints on Greek island are 5.7 million years old Nature journal, 06 September 2017.
3
Fossil footprints challenge established theories of human evolution Science Daily
journal, September 2017.
The Australopithecines arrive
Toumai and
the rest of the above named Ardipithecine hominids later became extinct,
to be replaced by a new type of hominids, called the Australopithecines. These hominids
had evolved one major human-like characteristic over the Ardipithecines: they walked about on two feet for most of
the time i.e. displayed bipedalism for longer periods.
It is from
Australopithecines, that all the other primitive human species of the genera
homo (such Homo habilis and Homo erectus) evolved from.
Dr Raymond Arthur Dart, a famous Australian anthropologist and lecturer at the University of Witwatersrand
is credited with discovering the very
first Australopithecine
fossil way back in 1925 in South Africa. The fossils were discovered in a Taung limestone quarry.
Dr Robert Broom discovered more Australopithecine
fossils in 1947 also in South Africa. Because the first Australopithecine
fossils were discovered in South Africa, the word "Australopithecus" was used for the species which means "southern primate." From the fossils Dart and Broom were sure that they represented ancient
forms of past human species long extinct, but at that time their colleagues and other academics outside South Africa were not so sure.
This is because at that time, paleoanthropology was still in its infancy, but just gaining ground a bit.
In the late 1800s, with the discovery for the first time of ancient human ancestor fossils such as Neanderthal fossils (1856), Cro-Magnon fossils (1868) and Java-man fossils (1891), alongside Darwin's evolution theories (1859),
anthropologists worldwide
were pretty sure that maybe ancient forms of humans once existed and fossils were out there to be discovered.
Dart's 1925 discovery was the second oldest ancient human ancestor fossils discovered in Africa. In 1921, Swiss miner Tom Zwiglaar, while eagerly searching for metal ore deposits in the limestone caves of Kabwe (also known as Broken Hill), in Zambia, discovered the very first early human ancestor fossils to be discovered in Africa. Scientists assigned
the Kabwe fossils as an example of Homo heidelbergensis (or Homo rhodesiensis as other anthropologists use).
Dart's discovery would later be hailed as a major find, when the fossils were shown to be very much older that than the
Cro-Magnon and Neanderthal fossils by over 2 million years.
Raymond Dart called his baby fossil Taung Child.
Years later scientists called Dart's discovery Australopithecus africanus
and dated it 2.5 million years ago. It was the earliest of several other Australopithecines discovered in Africa.
In 1947 also in South Africa, another Australopithecus africanus fossil was found in Sterkfontein by anthropologist Robert Broom.
It was a female so was promptly named Mrs Ple!
Despite these exciting initial discoveries of ancient human fossils which were beginning to prove that
Darwin's predictions of ancient humans fossils were out there to be discovered one day in Africa, Darwin's theories were still not universally accepted, even in the U.S.
by the start of the 20th century as evident in the famous Scopes Trial in 1925.
During this famous high profile trial of the century, the
celebrity lawyer of the day Clarence Darrow had tried but failed to defend a high school science teacher
named John T Scopes, who was famously charged with
violating a U.S. law that strictly prohibited the teaching of any of Darwin's Theories of Evolution. Mr Scopes was found guilty of the crime and given a very hefty fine.
It was only in the 1950s and 1960s when the famous
anthropologists Mary and Louis
Leakey, and many others discovered several significant ancient human fossils in Kenya, Ethiopia and Tanzania (complimenting the finds of Raymond Dart, Tom Zwiglaar etc), that anthropologists, teachers, academics as well as politicians and law makers worldwide finally accepted that
human evolution was in fact several millions of years old and Darwin's theory of evolution was spot on. The U.S. law under which John T Scopes was prosecuted was rightfully repealed in 1968 by the U.S. Supreme Court.
Some
biologists argue that Little Foot (mentioned above) was an early unique type
Australopithecine and not a member of the Ardipithecines. They postulate that Little Foot should be classified in a new
species called Australopithecus prometheus. So Little Foot may be positioned in the timeline of human evolution between the oldest dated Ardipithecine species and
earliest dated Australopithecine species. Displacing the famous Lucy (to be discussed below) as the oldest Australopithecus species.
According to Dr Alice Roberts in the entertaining BBC TV series Origins of US: Guts the need for longer periods of bipedalism began around 3 million years ago
due to adverse climate changes (with woodlands were shrinking and grasslands were expanding), forcing primitive Australopithecines to begin to search for food mostly on the grassland or open savanna grasses and no longer mostly in trees, as all the Ardipithecine members had done.
What climatic changes caused the appearances of huge areas of grasslands or open savanna grasses in Africa is one of the greatest mysteries, and had grasslands
not appeared 3 million years ago, then it is possible that human ancestors would have evolved
bipedalism much much later, because there would have been no need to leave the trees to look for food. Grasses will play another very important role in human history,
when in 12,000 BC wild cereal grasses (barley and wheat) become first plants to be domesticated, when humans began to adopt agriculture.
3 million years ago, grasslands or open savanna grasses began to appear all over pre-historic Africa, causing the Australopithecines to leave the trees, come down and try to walk on two feet and next evolve to walk properly on the ground.
Why did they leave the trees? Well food sources were now more plentiful on the ground, and survival mode kicked in!
To move about on the ground properly, they had to evolve skeletal features that allowed them to walk properly on two feet for longer periods.
If you watch the way a modern chimpanzee walks, it's so similar to the way a little child walks during its first week of
walking: side to side walking gait! That type of walking is not suitable for long periods and wastes
energy and soon wears the chimpanzee down and the reason why just-starting-to-walk toddlers get tired easily, after side to side walking gait for just 10 minutes.
In other words
the Australopithecines evolved to walk properly on the ground in order to adapt
to living and looking for food on the ground in grasslands and
permanently gave up looking for food in the tress or woodlands as the Ardipithecine family of hominids had done.
You can read about Lucy and how its discover stumbled across the fossil back in November 1974 in Ethiopia,
from the extra-ordinary book: Lucy: The Beginnings of Humankind by Donald Johanson and Maitland Edey, Simon & Schuster, 1990.
Lucy is also famous for leaving behind the world's oldest footprints made by a hominid, preserved on the remains
of an ancient volcanic eruption.
The famous Laetoli foot prints were made by three members of Lucy's species (
Australopithecus afarensis), 3 million years ago.
It was discovered in 1978 in Laetoli, Tanzania, by Mary Leakey and Paul Abell.
They are still the oldest foot prints made by our human ancestors.
The above diagram shows the many features of the famous Lucy (Australopithecus afarensis)
that excited anthropologists worldwide, when the hominid was studied in great detail in the late 1970s and early 1980s after discovery in 1974 in Ethiopia.
In 2000, Ethiopian anthropologist, Dr Zeresenay Alemseged discovered a fossil he named Selam or Lucy's Baby or (DIK-1/1) in the Dikika Afar Depression
of Ethiopia, not far from the Hadar region where Lucy was discovered in 1974. The discovery was officially announced in 2006 in the scientific journal Nature. Because it was a child hominid fossil
of Australopithecus afarensis the fossil was thus given the name Lucy's Baby. It however dates about just over
100,000 older than Lucy. Careful analysis of Salem's bones showed that the hominid was well adapted to climbing trees in addition to walking bipedally when on the ground.
BBC Science Report that Lucy may not be the oldest hominid that walked on two feet most of the time
Back in 1965 a
Havard University paleoanthropology expedition touring East Africa came across a fossil later named Australopithecus anamensis) It was discovered at
You can read more about the Ardipithecines, Australopithecines and Robust Australopithecines
in Professor Emeritus Robert Jurmain books on anthropology such as
the 14th edition of Introduction to Physical Anthropology.
Diagram below shows proximate locations of some important Ardipithecine and Australopithecine hominids found in Africa
Enter: Australopithecus sediba
If Lucy is the oldest human-like australopithecine yet discovered, what is the name of the most human-like australopithecine yet discovered?? This title goes to Australopithecus sediba
found in Malapa Caves at the Cradle of Humankind site (a World Heritage Site) in South Africa in 2007. It was dated
2.1 million years old. Although discovered in 2007
by Professor Lee Berger and colleagues at the University of the Witwatersrand (Johannesburg)
and 3D analysed (i.e. 3D scan) by radiologist Dr Jackie Smilg of the
University of the Witwatersrand,
its date was only officially confirmed in July 2012. Prior to the exciting 3D scan, the fossil was
no more than a simple lump of rock with teeth sticking out, but once Dr Jackie Smilg did
a thorough exploratory 3D scan,
an almost complete hominid skull was revealed hiding inside the rock!!
Scientists currently agree that Australopithecus
sediba is the best candidate for ancestor to most Homo habilis fossils, except the
earlier 2.6 million year old Homo habilis fossil discovered in Kenya
and most likely descended from Lucy (Australopithecus afarensis).
Both
Australopithecus sediba and Lucy thus
evolved into the first of several Homo species (Homo habilis and Homo erectus).
The Robust Australopithecines Arrive
The main differences
between Lucy and early Homo species (such as Homo erectus and Homo habilis) will be revealed later, but first
lets take a look at another very different species of hominids called Paranthropines or the Robust Australopithecines.
The robust australopithecines were once placed inside the genus Australopithecus (e.g. Australopithecus robustus instead of Paranthropus robustus)
but have since been categorised as part of the genus Paranthropus after detailed research. They are still seen as part of the broader clade of
australopithecine types, but today they have been placed in their own genus: Paranthropus.
As far as we know, they left no modern descendants, when they became extinct
1.4 million years ago. Some researchers believe that although Robust australopithecines
were bipedal like other australopithecines, they retained a significant capacity for arboreal living in trees.
Evolutionary History of the "Robust" Australopithecines
edited by Frederick E. Grine, (AldineTransaction, 2008), points out the robust australopithecines were
more or less, simply a mysterious side branch of human evolution, nature's weird experimentation that went extinct.
In May
1960, also at the
BREAKING NEWS: In March 2015, scientists from the United States eagerly fossil hunting at Ledi-Geraru in Ethiopia's Afar region claimed to have discovered the oldest fossil from our genus Homo: a 2.8 million year old fossil of
Homo habilis. The previous record for the oldest Homo habilis fossil was 2.6 million years ago, fossil discovered in Kenya. This absolutely amazing fossil find
was listed as the number 28 of the top 100 important discoveries of 2015 in Discover Magazine. If you look at the two small maps below, you will see that the new fossil find is not far from where
the famous Lucy (Australopithecus afarensis) fossil was discovered in 1974 (about 40 miles away). Not surprisingly the Ledi-Geraru fossils
shared a lot of features common with Lucy!
This supports the theory I mentioned earlier on that both
Australopithecus sediba and Australopithecus afarensis are the best candidates for ancestor of Homo habilis fossils
Location of amazing Ledi-Geraru fossils in Ethiopia.
November 2015 issue of Discover Magazine reports about the amazing 2.8 million year old fossil of Homo habilis
NEW UPDATED DATA
Although Lucy and all the other Australopithecines never made any stone tools,
on May 20th 2015, archaeologists have just announced to the world media a sensational discovery made
way back in 2011:
they
had confirmed via independent research, a 2011 discovery of stone tools made by our human ancestors dating 3.3 million years ago so possibly
Australopithecine stone tools!!! It was a remarkable discovery because up until May 2015, every single major paleoanthropology
textbook in the world stated clearly that: only homo species from Homo habilis were the
first to create stone tools, and the very first type of stone age (Old Stone Age
or the Palaeolithic era) began with the
arrival of Homo habilis Oldowan stone tools.
All paleoanthropology text books worldwide state that anatomically modern humans first appeared
200,000 years ago and before then
all the texts follow this timeline:
4 to 7 million years ago = The Ardipithecines
2.1 to 3.4 million years ago = The Australopithecines
1.4 to 2.6 million years ago = The Robust Australopithecines
2.4 to 2.6 million years ago = Homo habilis
2.4 million years ago to 40,000 years ago = Homo erectus (450,000-40,000 years ago = The Denisovans)
900,000 to 200,000 years ago = Homo heidelbergensis (450,000-38,000 years ago = The Neanderthals)
200,000 years ago to present = Modern humans or Homo sapiens
The sensational 2011 discovery was made not surprisingly
at a place called Lomekwi, near Kenya's rather famous Lake Turkana in northern Kenya near the border with Ethiopia.
Areas in and around the famous Lake Turkana as you may have noticed in the HTML eBook, have yielded lots of stone tools and
fossils of ancient humans AND the hominids dating from 4 million years ago (see diagram above for location of Lake Turkana).
However scientists are not saying if the these 3.3 million year old tools
are those of the Australopithecines or a much earlier primitive version of Homo habilis. The Jury is out to decide who made these tools!!
The discovery was published in the British Journal Nature by a group of scientists led by
Dr Sonia Harmand and Dr Jason Lewis of Stony Brook University in New York.
While monitoring several scientific forums discussing the amazing discovering today May 21st 2015,
several scientists and academics are pointing out that in 1999 a 3 million year old
Australopithecus (Kenyanthropus) platytops
fossil was discovered less than
mile from where the 3.3 million year old stone tools were discovered (see notes on Australopithecus
(Kenyanthropus) platytops above at section B on Australopithecines).
But there is no conclusive proof that Australopithecus (Kenyanthropus) platytops made the tools as of yet.
May 20th 2015 Los Angeles Times reports of 3.3 million year old ancient hominid stone tools
Even earlier than Olduvai where the first Homo habilis fossils were discovered,
are the rich fossil beds at East Turkana in Northern Kenya.
They have yielded fragments not only of gracile and robust australopithecines, but also of Homo habilis
as well. Both the Olduvai Gorge in Tanzania and Lake Turkana as well as areas at
East and West Turkana in Kenya, thus contain treasure-trove of other fascinating fossils of ancient humans and hominids waiting to be discovered one day.
Homo habilis may have started to
make stone tools, but they had not yet discovered how to make and control fire,
so they ate raw meat, fish etc as had other hominid species before,
supplemented by fruits and vegetables.
In 1984,
at Nariokotome near Lake Turkana (West Turkana) in
The 2.4 million year old specimen discovered at
East Turkana, is currently the oldest Homo erectus or Homo ergaster found to date.
If you recall earlier in this ebook, Scientists currently agree that Australopithecus
sediba is the best candidate for ancestor to most Homo habilis fossils, except the earlier
2.6 million year old Homo habilis fossil discovered in Kenya
and most likely descended from the famous Lucy fossil (3.2 million year old Australopithecus afarensis). The
2.4 million year old East Turkana Homo erectus fossil most likely descended from the 2.6 million year old Homo habilis fossil.
Both fossils remain the oldest Homo erectus / Homo ergaster and Homo habilis fossils.
Many differences between Homo erectus / Homo ergaster and Lucy were quiet obvious when studied side by side. A major difference between Lucy and Homo erectus / Homo ergaster was that
while Lucy was mostly a herbivore, the West Turkana fossils show it was mostly a meat eater or carnivore.
The change in diet was due to the fact that Homo erectus (Homo ergaster) had a bigger
brain than Lucy, so needed to eat more meat to provide sufficient fuel for the brain.
With this change in diet Homo erectus (Homo ergaster) evolved a smaller gut.
Herbivores like cows have larger guts than carnivores, because plant tissue is much harder to digest than
flesh and a much larger gut, as seen in cows helps the herbivore digest tough plant cellulose.
Did You Know that?
Plant cellulose is so tough to digest by herbivores gut enzymes alone, that all herbivores have additional help in the form of gut bacteria living inside them, to help them to digest cellulose. These gut bacteria have very specific enzymes called cellulase that can breakdown the tough beta acetal linkages that make up the biochemical structure of cellulose. Today thanks to evolution, cellulose is no longer a challenge to digest and all herbivores depend upon bacteria living in their guts to break down cellulose. Cows and other herbivores have a 4-chambered stomach, bacteria live in one of the chambers and are able to break down the cellulose. Termites also contain same bacteria in cows,
which breaks down the cellulose (in the wood they eat) for them. When humans eat plant cellulose such as cabbage, lettuce, salad etc, all of it goes undigested: humans are unable to digest cellulose because the appropriate enzymes to breakdown the beta acetal linkages are mysteriously absent. Undigested cellulose (cabbage, lettuce, salad) is thus used a fibre which aids in the smooth working of the intestinal tract. Humans however can eat carbohydrates like bread, pasta (and spaghetti), rice, yam and potatoes etc because we have the enzymes (amylase) in our tummies to break down starch. A mutation seems to have occurred in Homo habilis and Homo erectus when they began to eat meat more and ate cellulose much less than Lucy had done. This mutation caused these early homo species to gradually loose functioning cellulase enzyme production and early homo species had evolved smaller guts (which left NO space to store gut bacteria that have cellulase). Curiously Ardipithecines and the Australopithecines all had a working appendix. It was this appendix that stored the gut bacteria used to digest cellulose. The appendix in humans lost it ability to store gut bacteria to help digest cellulose by the time they were in the Homo habilis and Homo erectus stages. Today the human appendix is a sorry vestigial structure: totally useless!
Gorillas and chimpanzees too lost gut bacteria BUT have little trouble digesting cellulose thanks to the presence of the ciliated protozoan called
Troglodytella in their intestines. However, chimps and gorillas in captivity begin to lose their Troglodytella when they are fed cooked food by humans.
Thus, it is also reasonable to assume that humans many have also lost intestinal ciliated protozoa,
when they started cooking with fire in-between the Homo erectus and Homo heidelbergensis stages.
Why Do Homo Species Have Bigger Brains Than Earlier Human Ancestors?
When later species of ancient humans (i.e Homo heidelbergensis) permanently used fire to cook raw
flesh,
their brain sizes evolved to become even much bigger than Homo erectus, Homo habilis and the Australopithecines,
because cooked meat provides much more energy than
uncooked raw flesh, so Homo heidelbergensis and later modern human brains could afford to become bigger via evolution and natural selection. However bigger brains mean bigger heads
and at child birth, mothers have to the endure painful part of giving birth, due to babies
large heads in proportion to the rest of body of the babies.
In the fascinating book titled Catching Fire: How Cooking Made Us Human by Richard Wrangham (ISBB-13 978-1846682865, 2010) Dr Wrangham
points out that it was the habit of eating cooked food rather than raw food that
permitted the digestive tract (our gut) to shrink in order for the human brain to grow bigger in size compared to the other primates such as chimpanzees
that continued to eat raw flesh.
Meat and Early Human Diets
We have to remember that early homo species from Homo erectus
did not have access to high energy rich carbohydrates like bread, pasta, maize (corn), rice and potatoes. These were only cultivated
from circa 12,000 BC. The diet of our early human species was so poor that today it would not be able to sustain us for no more than a
few days. At that time early humans ate the odd nuts, raw tubers, wild grasses, wild fruits etc. None of these provided sufficient calories. However it was flesh (cooked and un-cooked) that provided the energy needed to eventually boost brain sizes.
Today we all know our huge range of carbohydrates provide more energy than cooked meat,
so today's humans can afford to eat more rice but less fried
chicken or roasted pork in a single meal and still provide the minimum energy requirements needed by our brains.
The Most Important Gene Tweaks (Mutations) That Aided Bigger Brain Sizes
Molecular geneticists and biochemists have finally identified two very important genes whose mutations caused Homo erectus species to develop larger brain sizes: after the human line
split from the chimpanzee lineage 7 million years ago, two genes that mutated were identified as SLC2A1 and SLC2A4. Both triggering bigger brain sizes in the Ardipithecines and Australopithecines.
In Homo erectus species the genes underwent much further mutations.
These two gene mutations both build proteins that transport glucose in and out of cells. The gene tweaks (via evolution)
took glucose away from muscles and into the early hominid brains. The glucose would then have boosted the brains, allowing them to grow bigger. Homo erectus species
got a big boost in brain sizes when they began to eat raw meat in large quantities. Ardipithecines and Australopithecines did not eat meat
a lot so did not get the extra boost in brain sizes, but SLC2A1 and SLC2A4 did begin with the arrival of
the Ardipithecines and Australopithecines!
Remember that large brain sizes of our human ancestors began much earlier: around 10 million
years ago, a descendant of Pierolapithecus catalaunicus (recall earlier on in this eBook, I mentioned that it
was the best candidate for a common ancestor of humans, gorillas
and chimpanzees) underwent an important evolutionary changes in brain sizes.
Molecular geneticists discovered a
mutation in the gene known as RNF213 caused more blood to flow to the brain, increasing the sizes of the brain in relative size to the body.
What triggered this particular mutation is currently unknown.
Incidentally just before the divergence of humans and chimps 7 million years ago,
a big difference in the ASPM gene and the MCPH1 gene in both human and chimp ancestors had also occurred. Small changes in the ASPM gene was the cause of the big difference in brain size between humans and chimps. Meanwhile the MCPH1 gene (called Microcephalin) which controls the start of brain size development in foetuses, was expressed early, explaining why human babies have bigger brain sizes than baby chimps. Both genes are what caused humans to have much bigger brain sizes in adulthood compared to chimpanzees.
A big brain is thus a major characteristic of genus Homo, though the actual size may vary. Homo habilis has the smallest and Neanderthals had the largest brain size, modern human brains take second place.
The increase in brain sizes meant Homo
erectus could now develop skills in making more advanced tools than Homo
habilis.
In the final analysis, all humans today owe our bigger brain sizes due two mains reasons. Firstly humans underwent
lucky gene mutations such as the changes that occurred around 7 million years ago in the
ASPM and MCPH1 genes, changes that occurred before 7 million years ago in the SLC2A1 and SLC2A4 genes,
as well as the ancient gene mutation that occurred in the RNF213 gene 10 million years ago.
Secondly when our human ancestors began to eat raw flesh, then cooked flesh instead of a mostly plant based diet of wild nuts and wild fruits,
this complimented the gene tweaks (gene mutations), allowing humans to receive brain size boosts and becoming
the most successful, creative and innovative primates today.
Homo Erectus and Body Hair
Hypothetically if we were able to travel back in times when Homo erectus was around in the later stages of their evolution, one of the amazing things we would find similar to us, was like of the lack of
fur on the body except on the head. But if we were able to travel back in times when Lucy was around, we would be amazed by how much fur Lucy had all over her body,
as if she was wearing a thick long black mink coat!
Modern humans today had previously lost all their natural body fur-like hair about 1.5 million years ago when humans existed as
Homo ergaster in Africa or as Homo erectus in Asia. These human ancestors had evolved to lose all their
their natural body fur, (which their ancestors Homo habilis had)
to keep cool, after moving to live in open hot and dry savannah areas. Following this migration into savannah
areas Humans evolved to control their body temperature once moving into open savannah, by sweating.
Body sweating is only efficient, if there are no furs on the body
The thick hair on heads of all humans was left there to protect it from over exposure to the sun. If humans had not lost their body furs, then during very hot weather periods
we would have to pant a lot, with our tongues sticking out like dogs or lions do during hot and dry spells of afternoon
sunshine. Chimps and other primates which retained body fur and live in hot tropical Africa, have evolved sophisticated body
temperature systems that prevent them over heating in the hot tropical sun.
But humans are not the only few rare examples of mammals without fur: pigs, hippos, rhinos, elephants and whales
are a few rare examples of mammals without body fur, but they lost their fur for completely different reasons. For instance hippos and whales lost theirs, because of their love for spending so much time playing and resting in water and evolution doing the right thing by making them fur-less.
Out of Africa: The Very First Migration Just Before 1.8 million Years ago
One
group of Homo erectus did however
remain permanently in
The cave above in Greece, was the site of the 710,000 year old Petralona man fossils discovered in 1960.
Some anthropologists do not agree about the classification of Ceprano man fossils,
such as in the textbooks written by Professor Emeritus Robert Jurmain, and classify
Ceprano man as the sole representation of Homo erectus in Europe.
Today most anthropologists classify Ceprano man in Italy and Petralona man fossils in Greece
as Homo heidelbergensis
fossils and the Dmanisi discoveries in Georgia
as Homo erectus fossils.
BREAKING NEWS: In summer 2013, Spanish scientists discovered what is surely proof that Homo erectus did in fact reach Europe after all.
The fossils were discovered at Barranco Leon in the region of Orce in southern Spain, and date circa 1.4 million years ago. This discovery complimented
another discovery made five years earlier in 2008 in Spain at Sima del Elefante dated 1.2 million years old. Since Homo heidelbergensis had not yet evolved in Africa before 1 million years ago,
both fossils are now being classified unofficially as Homo erectus fossils, and the oldest hominid fossils found in Europe.
There has not been any official announcement that the Barranco Leon and Sima del Elefante fossils are Homo erectus fossils. Tools found near the
fossils were identified as Acheulean tools, same ones use by Homo erectus. You can read more about this discovery from the source below:
The Oldest Human Fossil in Europe, from Orce (Spain) Journal of Human Evolution July 2013. Vol 65(1):1-9
No Homo erectus species had yet reached North or
Diagram above Homo erectus/ergaster main discovery locations (2.4 million to 1 million years old): Africa, Georgia (central Asia), China and Indonesia.
Homo erectus did not reach Europe proper (save for southern Georgia), as the oldest hominid fossils ever found in Europe proper
belong to Homo heidelbergensis/Homo antecessor species, the oldest was discovered at the
Gran Dolina limestone caves in the Sierra de Atapuerca in Spain, and dated 810,000 years old (discussed later in detail). However as I have mentioned earlier on
in summer 2013, Spanish scientists discovered what is surely proof that Homo erectus did in fact reach Europe after all.
The fossils were discovered at Barranco Leon in the region of Orce in southern Spain, and date circa 1.4 million years old.
NEW UPDATED DATA. In October 2013, several much older Dmanisi fossils were discovered again in southern Georgia. It was a sensational find. This time
the oldest of the several fossils was dated 1.8 million years old. More research is ongoing on these new finds. but as indicated below, since the oldest Asia Homo erectus fossils date 1 million years ago (i.e. Java man), it seems that Homo erectus, migrating from Africa did indeed reach the areas around southern Georgia and Armenia in large numbers before moving onto Asia proper. The very old date of the fossils could indicate Homo erectus could have left Africa much earlier than previously thought.
Another interesting theory, but still to be widely proven internationally, was that when the various Dmanisi fossils were closely examined,
it was noticed there were distinct variations in skull dimensions between them and the time span between them was estimated at several thousand years.
These variations were compared with those of supposedly different species of human ancestor that lived in Africa at the time: i.e. Homo habilis
(3 million years ago), Homo ergaster (2.3 million years ago) and Homo rudolfensis (1.99 million years ago), notice that the time span
between them is also estimated at several thousand years. They concluded that the variation among them was no greater than that seen at Dmanisi.
So rather than these older African fossils being separate homo species, the human ancestors found in Africa may have simply been normal
variants of Homo erectus. Thus if theory is proven to be universally correct, then paleoanthropology texts around the world need to be
edited to state that Lucy, the first of several Australopithecines discussed earlier on, evolved directly into variants of Homo erectus
(i.e. older and newer forms of Homo erectus). Therefore Homo habilis, Homo ergaster, and Homo rudolfensis never existed!! This theory
is bound to unwind the hard work of previous research projects which support the notion that
Homo habilis, Homo ergaster and Homo rudolfensis did exist before Homo erectus.
The age of the oldest Dmanisi fossils, may also cause problems with
the current theory that it was Australopithecus Sediba that evolved into Homo habilis, (discussed earlier on in this ebook
at the topics covering the Australopithecines). So the new theory can be revised to say Australopithecus Sediba evolved into
Home erectus and not Homo habilis.
Its early days and perhaps in a few years time we will know which theory is correct.
In the Middle East, we find the next oldest
dated and verified evidence of Homo erectus occupation western Eurasia, after the Dmanisi fossils in Georgia.
The site at Ubeidiya in Israel , dates 1.43 million years old, hence much younger that the latest
Dmanisi fossils discovered in 2013 (1.8 million years old), even though Israel is closer to Africa than Georgia. It is possible that
older Homo erectus fossils in Israel have been lost in time.
BREAKING NEWS: In summer 2013, Spanish scientists discovered what is surely proof that Homo erectus did in fact reach Europe after all.
The fossils were discovered at Barranco Leon in the region of Orce in southern Spain, and date circa 1.4 million years old. This discovery complimented
another discovery made in 2008 in Spain at Sima del Elefante dated 1.2 million years old. Since Homo heidelbergensis had not yet evolved in Africa before 1 million years ago,
both fossils are now being classified unofficially as Homo erectus fossils, and the oldest hominid fossils found in Europe.
There has not been any offical anouncement that the Barranco Leon and Sima del Elefante fossils are Homo erectus fossils. Tools found near the
fossils were identified as Acheulean tools, same ones use by Homo erectus. You can read more about this discovery from the source below:
The Oldest Human Fossil in Europe, from Orce (Spain) Journal of Human Evolution July 2013. Vol 65(1):1-9
In eastern Asia were we find two major fossils in
Scientists estimate that Homo erectus survived up to 36,000 years ago in Asia and Europe but went extinct much much earlier in Africa.
BREAKING NEWS
In September 2015, South African scientists with much excitement in a press conference, announced that they have discovered a
new species of our genus homo: they are calling the species Homo naledi, and it since been provisionally dated 1.95 million years ago. This means it may
have existed around the time Homo erectus exixted as well.
But the dating is just a preliminary estimate, as the exact age of the new species is still being determined in the labs of the
University of the Witwatersrand, in Johannesburg, a multi-campus South African public research university. The fossils were discovered
in a cave called Rising Star, some 30 miles northwest of Johannesburg. It was first discoverd in 2013 by a team led by Dr Lee Berger.
BREAKING NEWS: In April 2017, one of the discoverers of the Homo naledi fossil, Dr Lee Berger has shocked the entire scientific community by
announcing that Homo naledi is only between 200,000 and 300,000 years old!! and not the 1.95 million years earlier projected. This means that
Homo naledi CANNOT be related to Homo erectus.
September 2015 scientific report in National Geographic magazine
about the discovery of a new human species.
With The New April 2017 Dating of Homo naledi Is This Ancient Human Species Similar or Related
to the Mysterious Homo helmei and The Strange Case of Albery Perry?
Recall the oldest anatomically modern humans and the accepted accurate dating of the Mitochondrial Eve and Y-Chromosome Adam (discussed in great detail in Section E in the part of Y-Chromosome DNA haplogroups)
shows that modern humans only came into existence roughly 200,000 years ago. All this was somewhat thrown into doubt when news about a one Mr Albery Perry
began to make headline news back in 2013.
Mr Albert Perry was an African American, whose family members out of curiosity sent his
DNA for testing to trace his African ancestry, but in doing so, opened a can of worms about the age of anatomocally modern humans. When the DNA of
Mr Albert Perry was tested, it was shown that Mr Albert Perry's was very ancient and dated
338,000 years old! The age of Mr Perry's DNA is further proof that there are anatomically modern humans (i.e. in this case Mr Albert Perry) that
are older than 200,000 years old.
Scientists have concluded
that Mr Albert Perry's DNA came into existence when the vast majority of earlier
humans
were at the Homo heidelbergensis stage
in Africa and existed as the Neanderthals in Europe and Western Asia and the Denisovans in Eastern Asia. The problem
is Homo heidelbergensis was not yet anatomically modern human!! Homo heidelbergensis species which all evolved from Homo erectus is discussed later on, at the
end of this segment on Homo erectus.
Scientists theorised that just after 200,000 years ago, a group of anatomically modern humans i.e. archaic Homo sapiens
had a chance encounter with a group of surviving Homo heidelbergensis humans (whose normal ancestry went back 338,000 years ago).
This is possible because Homo heidelbergensis did not instantly disappear when anatomically modern humans evolved 200,000 years ago,
instead Homo heidelbergensis was gradually reduced in population numbers over thousands of years competing unsuccessfully with anatomically
modern human for resources such as food and caves for shelter. Soon Homo heidelbergensis became extinct. However the chance encounter did not
end there, some form of mating actually took place during the encounter.
This cross-species mating took place only in Cameroon where the original ancestors of the Mbo people lived.
The result was hybrid or introgression: offspring containing both Homo heidelbergensis genes and anatomically
modern human (archaic Homo sapiens) genes: Albert Perry's ancestral mother is believed to have mated with a male Homo heidelbergensis
and the Y chromosome DNA has passed down the male line to Albert Perry's ancestors! This explains why Mr Albery Perry's DNA is over 338,000 years old
Introgression may also explain the mystery of Florisbad Fossils, (discussed in detail near the end of Section C). Briefly, way back in
in 1932, near the city of Bloemfontein, South Africa, zoology Professor T. F. Dreyer stumbled upon the so-called Florisbad fossils,
and was later dated as circa 259,000 years old. There was a problem with this fossil that puzzled other scientists later in the 1960s and more recently in the 1980s: Florisbad fossils were definitely not anatomically modern human, lacking the several prominent features associated with anatomically modern human. Even more surprising was the fact that the fossils did not seem to have the prominent features of
Homo heidelbergensis, the ancestor of anatomically modern humans and also the last common ancestor of modern humans and Neanderthals.
So scientists gave the mysterious Florisbad fossils a new species name: Homo helmei.
Scientists today conclude that Florisbad fossils existed when Homo heidelbergensis was
slowly evolving into anatomically modern human, hence Florisbad fossils had features that were in transition between Homo heidelbergensis
and anatomically modern humans. In other words Florisbad fossils are an intermediate form between Homo heidelbergensis and Homo sapiens .
Homo helmei is one of many human species that has failed to gain widespread recognition. Textbooks tend to either mention it only in passing, or not at all!
With this in mind, is Homo naledi yet another case of Introgression?? More research work on Homo naledi
in the future on may soon answer this question. Later on in Section C, I will discuss more about
Professor Chris Stringer, one of Britain's best known leading paleoanthropologist, who in in early August 2016 had
presented a ground-breaking research paper, mentioned in the journal Philosophical Transactions in which
he theorised that the lineage that led to anatomically modern humans might well be at least 250,000 years to 500,000 years old and not 200,000 years
old as previously accepted by scientists. Professor Stringer predicts that one day paleoanthropologists will discover anatomically
modern human fossils in Africa and elsewhere, that are older than 200,000 years old. Homo naledi is not an anatomically modern human fossil, but it does indicate that
one day the history of human evolution from Homo erectus to Homo sapiens may have to be rewritten. See Section C for more details, under the sub-heading
ARE MODERN HUMANS MUCH OLDER THAN 200,000 YEARS OLD?
BREAKING NEWS: In early 2016, Chinese scientists confirmed that the discovery in 2012 of several Homo heidelbergensis specimens dating back to 900,000 years ago
in Yunxian in Hubei Province in China, makes the origin of Homo heidelbergensis a mystery. The scientists are looking at a possible scenario:
Homo heidelbergensis originated in Asia and spread to Africa and Europe. Thousands of years later
while Homo heidelbergensis living in Europe and Asia evolved into the Neanderthals and the Denisovans circa 350,000 to 400,000 years ago respectively.
In Africa, Homo heidelbergensis evolved into archaic Homo sapiens about 200,000 to 300,000 years ago. The problem with this postulation is that
Homo heidelbergensis originated in Asia is that molecular genetics say otherwise. By the time you read Section E in full, you will see that molecular genetics
shows quite clearly that Homo sapiens could not have originated in Asia, but originated in Africa, it may have been possible that
the Homo heidelbergensis in Africa DID have an Asian origin. Only DNA can solve this mystery, but up till today, scientists have not been able to extract
Homo heidelbergensis DNA from existing fossils in Africa, Asia and Europe.
Notice how similar Homo heidelbergensis is to the Neanderthals, both have the characteristic huge brow ridges (or supraorbital ridge) above the eyes.
Brow ridges soon get smaller and smaller once
Homo heidelbergensis evolves into archaic Homo sapiens 45,000 years ago, such as the Cro-Magnons in Europe.
It was given the name Homo antecessor,
other anthropologists disagree with this classification and say the fossil
is a member of the Homo heidelbergensis species.
The oldest Homo heidelbergensis
fossil found in
Aside from Spain and Britain, the following places in Europe have significant Homo
heidelbergensis discoveries:
The 800,000 year old Ceprano Man fossils was discovered by Italo Biddittu in Italy in 1994, (research is supporting the view that
Ceprano man is indeed a very early species of Homo heidelbergensis and not a later species of Homo erectus).
In Greece in 1960, an ancient cave with human fossils was discovered by Fillipos Chatzaridis, a local shepherd. The cave contained the 710,000 year old Petralona man fossils.
They are the oldest Homo heidelbergensis fossils in southern and Eastern Europe. The oldest
Homo heidelbergensis fossils in France were discovered between 1964 and 1974. They were named the
Tautavel Arago fossils (after discovery in town of Tautavel in the French Pyrenees) and dated 400,000 years old.
The word "heidelbergensis" comes from the site where the very first Homo
heidelbergensis fossils were found. In 1907 a Homo
heidelbergensis specimen was discovered at Mauer southeast of Heidelberg in Germany. Anthropologists agreed to
call all similar fossils found elsewhere around the world, including in Africa:
heidelbergensis. The Mauer fossils in Germany were dated 700,000 years old and are the oldest such fossils in Northern Europe. In Eastern Europe,
among important Homo heidelbergensis fossils is the famous Vértesszöllös Man fossils found in Hungary and dated 570,000 years old.
In the Middle East, among prominent Homo heidelbergensis fossils is the Gesher Benot Ya'aqov fossils discovered in Israel, on the banks of the Jordan River, and
dated 790,000 years old. These fossils also provided evidence of the earliest controlled fires made by our human ancestors
Fire use is the most human skill displayed by our human ancestors, aside from making stone tools!
The oldest evidence of fire control in Europe dates from around 500,000 years ago.
Among the oldest Homo
heidelbergensis found in Asia are the Tham Hai and Tham Khuyen fossils discovered in Vietnam and dated 430,000 years old. In
NEW UPDATED DATA In February 2014, archaeologists in Britain announced the sensational
finding of the oldest Homo heidelbergensis / Homo antecessor footprints (not fossils) in northern Europe, dated about 650,000 years ago.
The discovery was made at Norfolk (East Anglia) at Happisburgh, which is not far from Pakefield, where the oldest
Homo heidelbergensis fossils found in Britain were discovered.
Both Happisburgh and Pakefield are rich sources of prehistoric remains containing the oldest human fossils in Britain, along side Sussex which yielded the 500,000 year old Boxgrove man.
The other key palaeolithic and mesolithic sites in the UK are Pontnewydd, Kent's Cavern, Paviland, and Gough's Cave.
Homo neanderthalis: The Neanderthals Arrives (Middle Paleolithic era)
Meanwhile the world record for the oldest DNA extracted from a Neanderthal fossil was in 2006 when French and Belgian scientists managed to extract 100,000 year old Neanderthal DNA from fossils.
Among Professor Svante Pääbo published works about the Neanderthal genes, I recommend this recent publication: Neanderthal Man: In Search of Lost Genomes,, published in 2014.
Below are two different science reports on the exact
amount of Neanderthal DNA in humans today in Eurasia.
1)
The genomic landscape of Neanderthal ancestry in present-day humans Nature, 507, 354-357 (20 March 2014).
This is a recent study (published in the British Nature journal) of unique Neanderthal genes found in some populations in Eurasia today, carried out by a team of scientists led by Professor Svante Pääbo (at the Max Planck Institute for Evolutionary Anthropology).
Back in 2005, The Max Planck Institute for Evolutionary Anthropology in Germany
had launched a project to reconstruct Neanderthal genomes, working with Connecticut-based 454 Life Sciences and in 2009, the Institute announced the "first draft" of a complete Neanderthal genome.
2)
NEANDERTALS LIVE! This links to popular anthropologist John Hawks blog and an interesting take on Neanderthal Genes in a small population of humans in Eurasia today.
In the book The Human Story: Where We Come from & How We Evolved by Dr Chris Stringer notes that one remarkable thing about the
Neanderthals was that they were were very good experts in living in extremely
cold weather, well below -40 degrees celsius! The Neanderthals survived the longest spells of severe cold weather (during glaciations of the Last Ice Age)
ever endured by any early homo species.
Scientists say that the very last Ice Age began 4 million years ago. Before then at least five major Ice Ages
have occurred throughout Earth's history, the earliest was over 2 billion years ago.
During each Ice Age, several glaciations occurred and disappeared over thousands of years.
The last glaciations of the last Ice Age began about 750,000 years ago and ended permanently about 12,000 years ago.
this makes the Neanderthals the first early homo species to live through the last Ice Age glaciations.
While the Neanderthals had the characteristic huge brow ridges or supraorbital ridge above the eyes as found in all early homo species discussed earlier on, they had one new characteristic: They had several cold weather adaptations such as having a short stocky build, a large nose to warm cold air before it reached the lungs and had much more hair on the body compared to humans today.
NEW UPDATED DATA
The Neanderthals Drew the Oldest Caveman Paintings
In 2012, scientists from the University of Cordoba in Spain discovered 42,000 year old caveman paintings found in the
Nerja Caves (in the Province of Málaga, southern Spain) made by several families of Neanderthals living in the caves.
They are the oldest caveman paintings in the Europe, much older than the famous Lascaux Cro-Magnon
caveman paintings discovered in France dating 20,000 years ago. The much older Chauvet Cro-Magnon
caveman paintings in France date 35,000 years ago. Both these ancient French caveman paintings were made by
anatomically modern humans (i.e. the Cro-Magnons). Since the Neanderthals were not yet anatomically modern humans,
the world's oldest caveman paintings made by anatomically modern humans were found in Indonesia,
dated at least 40,000 years old. They were found at Karst Caves of Sulawesi, an island
east of large island of Borneo.
2010 science report on the world's oldest caveman paintings found in Indonesia
The dates of these caveman paintings brings up an interesting discovery: since Africa is the origin of anatomically modern humans (circa 200,000 years ago in Ethiopia, i.e. Omo Kibish fossils)
we would have expected Africa to host the oldest anatomically modern humans cave paintings. This is not the case yet, as the oldest
anatomically modern humans cave paintings discovered so far in Africa date from 26,000 years ago,
discovered in Namibia (the famous Apollo 11 Caves).
However South Africa is also home to the oldest caves used by anatomically modern humans:
Pinnacle Point Caves in Mossel Bay date from 170,000 years ago (Middle Stone Age period).
BREAKING NEWS
In 2014 Professor Thomas Higham (Oxford University) performed the
most comprehensive dating of Neanderthal bones and tools ever carried out by a scientist,
which demonstrated that Neanderthals died out in Europe between 41,000 and 39,000 years ago. The last
residence of the Neanderthals was discovered in caves found in th British enclave of Gibraltar, in southern Spain. The scientist also
discovered that both the Cro-Magnons (i.e. Homo sapiens) and the Neanderthals lived in side by side in
Europe for up to 5,000 years. It would have been great if the Cro-Magnons had drawn pics of them alongside other Neanderthals or even Cro-Magnons!!!
but we have to remember that the oldest caveman paintings in Europe, the
Chauvet Cro-Magnon caveman paintings in France, date 35,000 years ago. Since the Neanderthals
died out in Europe between 41,000 and 39,000 years ago, we can theorise that while the Neanderthals lived alongside Cro-Magnons for at least 5,000 years,
the Cro-Magnons had not yet started drawing!! Strange that the Neanderthals themselves who were the first to draw paintings in Europe,
did not draw caveman paintings showing them alongside the Cro-Magnons.
Recall that I had mentioned earlier on that the oldest caveman paintings in the Europe date from
42,000 years ago (found in the Nerja Caves of Málaga, southern Spain).
That the Neanderthals lived alongside modern humans for at least 5,000 years backs the view of some archaeologists that relatively late advances in Neanderthal stone tool technologies
and their use of jewellery as well as wearing clothes, were copied from modern humans.
Did the Neanderthals learn caveman paintings from the Cro-Magnons or did they develop it independently?
2014 BBC Science Report on Professor Thomas Higham's amazing discovery about the last Neanderthals on Earth.
Comparing Stone Tools: The Spread of Lithic Cultures from Homo habilis to the Neanderthals
Lets take a look at one fascinating thing that is quite unique to our early human ancestors: making stone tools. Early
humans used stone tools continuously from 2.6 million years ago until they discovered metals such as
copper (first used circa 7000 BC in ancient Turkey) and tin leading to the Bronze Age, circa 4000 BC (or 6000 years ago), then later the Iron Age circa 1500 BC.
The Neanderthals used stone tools that were very very different from those
used by Homo erectus and Homo heidelbergensis (i.e. the older Acheulean tools.) Scientists
gave the name Mousterian for the tools made by the Neanderthals. The more advanced stone tools
made by anatomically modern humans from Africa from 100,000 years ago are termed Aterian tools.
We recall the earliest stone tools (very primitive)
were used 2.6 million years ago by Homo habilis, known as Oldowan tools
BREAKING NEWS: Although Lucy and all the other Australopithecines never made any stone tools,
on May 20th 2015, archaeologists announced to the world media the sensational discovery made early this year:
that they
had discovered stone tools made by our human ancestors dating about 3.3 million years ago so possibly
Australopithecine tools!!! It was a remarkable discovery because up until May 2015, every single paleoanthropology
textbook in the world stated clearly that: only homo species from Homo habilis were the
first to create stone tools, and the very first type of stone age (Old Stone Age
or the Palaeolithic era) began with the
arrival of Homo habilis Oldowan stone tools. The sensational discovery was made not surprisingly
near Kenya's famous Lake Turkana in Northern Kenya near the border with Ethiopia.
Areas in around Lake Turkana as you may have noticed in the ebook, has yielded lots of stone tools and
fossils of ancient humans AND hominids dating from 4 million years ago (see diagram above for location of Lake Turkana).
However scientists are not saying if the these 3.3 million year old tools
are those of the Australopithecines or a much earlier primitive version of Homo habilis. The Jury is out to decide who made these tools!!
The discovery was published in the respected British Journal Nature by a group of scientists led by
Dr Sonia Harmand and Dr Jason Lewis of Stony Brook University in New York.
May 20th 2015 Los Angeles Times reports of 3.3 million year old ancient hominid stone tools
The Story of Human Evolution There are so many videos on YouTube about Human Evolution. This is one of the best. It is 1 hour 30 minutes long,
so go get some drinks and popcorn before watching it.
Several species of early primitive humans now are
living the entire world.
In Africa, we find, Homo erectus,
Homo ergaster and Homo
heidelbergensis. All living together in harmony, looking for food, hunting wild animals, raising kids and
minding their own business.
In
In
The two new species mentioned in Asia (The Hobbits and the Denisovans), deserve an introduction:
Who were the Hobbits?
During the 1950s and 1960s, a Dutch priest named Father Theodor Verhoeven
who lived and worked on Island of Flores in southern Indonesia discovered archeological sites
and conducted excavations at many of these sites. One famous site, known as Liang Bua
was decades later in 2003 identified as containing fossils belonging to a brand new homo species
later named "Hobbits" or
Homo floresiensis. The site was dated as having existed 600,000 years ago!
In 2003 with the existence of Homo floresiensis confirmed, following the discovery of
more fossils on the Island of Flores, scientists set about to try and explain where the Hobbits
fit in the timeline of human evolution. The name "Hobbit," comes from the human midgets
mentioned in J.R.R. Tolkien's fantasy novels:
Lord of the Rings.
There is still a lot of debate today. While the majority of scientists agree the Hobbits of Flores
are a distinct species, others, such as anthropologist Robert D Martin of Chicago's
Field Museum, argue the Hobbits belong to small-sized archaic Homo erectus, who probably suffered
from microcephaly, a condition in which the brain fails to grow to normal size (dwarfism theory of the Hobbits).
The date of the fossils, i.e. 600,000 years old, supports the theory
that the Hobbits were an offshoot of
Homo erectus that existed alongside normal sized Homo erectus Java Man in Indonesia. Their fossils also showed that the Hobbits were not
related to later appearance of Asian Neanderthals as the Denisovans are (discussed below).
Perhaps after Homo erectus moved to the Island of Flores (crossing the Wallace Line),
it began to shrink in size over the generations by a process known as Island Dwarfism,
which has been seen to occur in other species. When inhabitants on island are separated from other
major areas over thousands of years, and limited food sources are available, animals are known to
shrink in size, due to natural selection stimulus, so that they can survive on that isolated island much longer.
Nature always tries hard to find a way to make life improvise in the face of survival setbacks
The Hobbits co-existed with Asian Homo sapiens until 12,000 years ago.
The reasons why the Hobbits became extinct 12,000 years ago is not clear, but food competition with
the more advanced Asian Archaic Homo sapiens is not ruled out.
BBC Science report supports the dwarfism theory of the Hobbits
Who are the Denisovans?
The Denisovans, were an extinct human species known to
exist from the sensational discovery of a 80,000-year fossil found in a Siberian cave (i.e. Asian part of Russia) in 2010 by Dr Matthias Meyer, Professor Svante Pääbo and collegues
at the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany. Nobody knows what Denisovans
looked like because there are so few fragmented fossils. However anthropologists agree that Denisovans were
cousins of the Neanderthals. Denisovan lineage branched off from the Asian Homo heidelbergensis ancestry
500,000 years ago, before splitting into Asian Neanderthals and the Denisovans. The arrival of
advanced Asian archaic Homo sapiens led to the extinction of the Denisovans. However modern day people of
Pacific Ocean islands of Melanesia, such as the Papua New Guineans and people of the Solomon Islands have small amounts of Denisovan DNA. This is
because early archaic Homo sapiens living in southeast Asia from about 37,000 years ago interbred on a large scale with
some groups Denisovans passing on their genes to 6% of modern day populations of Melanesians.
The reasons why the Denisovans became extinct 25,000 years ago is not clear, but food competition with
the more advanced Homo sapiens is not ruled out as in the case of the Hobbits.
This compares with the fact that 2% of Eurasia populations today have Neanderthal DNA due to instances of interbreeding
between Cro-Magnons (European early versions of Homo sapiens)
and the Neanderthals, from about 41,000 years ago up to 39,years ago.
2014 science journal, reports that more than 2% of Eurasia populations today have Neanderthal DNA.
A lot more sexual encounters between Neanderthals and ancient modern humans took place.
NEW UPDATED DATA In December 2013, scientists led by Professor Svante Pääbo at the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany announced that they had retrieved the oldest ancient human DNA from a fossil (recovered in Spain at the famous Sima de los Huesos site)
dating back to 400,000 years ago. The previous world record had been DNA belonging to a Neanderthal fossil dating 100,000 years ago (set by French and Belgian scientists in 2006).
It was possible using a technique called Polymerase Chain Reaction or PCR in which just a very minute
amount of DNA (less than a milligram or picogram) can be amplified thousands times to sufficient quantities for research work.
Initially before the DNA was analysed, Professor Pääbo and his team suspected it belonged to Homo heidelbergensis,
since Spain is rich in Homo heidelbergensis fossils dating between 810,000 to 300,000 years old (such as at Sima de los Huesos and at Gran Dolina
limestone caves in the Sierra de Atapuerca.)
However the surprise result of the DNA analysis indicated it actually belonged to a group of Denisovans
living in Spain 400,000 years ago! How these groups of Denisovans came to be living in Spain,
when previous data suggested they lived mostly in Siberia,
eastern Asia, Australia and Melanesia, was a big big surprise.
But there is universal agreement that Denisovans were
cousins of the Neanderthals. Denisovan lineage branched off from the Asian Homo heidelbergensis ancestry
500,000 years ago, before splitting into Asian Neanderthals and the Denisovans.
And maybe, just maybe some groups of these Denisovans migrated westwards towards Spain by chance, while following wild game migration from east to west.
New York Times report on the oldest ancient human DNA ever extracted (400,000 years ago).
Since anatomically modern humans only appeared 200,000 years ago (more of this explained in Section E), the oldest anatomically modern humans DNA extracted was
the 60,000 year old mitochondrial DNA extracted from ancient Mungo Man fossils by anthropologist Dr Alan Thorne in Australia in the 1999, (it had been discovered in 1974 by Dr Jim Bowler). A list of the oldest anatomically
modern humans is given later on (see "COUNTDOWN TO THE OLDEST ANATOMICALLY MODERN HUMANS"). In this list are anatomically modern human fossils that are much older than Mungo Man fossils.
The oldest fossil is the Omo Kibish fossils found in Ethiopia in 1967 and dated 195,000 years old,
but scientists have not yet extracted DNA from the Omo Kibbish fossils.
BREAKING NEWS: In early June 2017, excited scientists discovered further proof of Professor Chris Stringer amazing prediction that
the lineage that led to anatomically modern humans might well be over
at least 250,000 years old and not 200,000 years old as previously accepted by scientists (i.e. Omo Kibish fossils in Ethiopia). In Morocco, a team led by anthropologist Dr Jean-Jacques Hublin at the Max
Planck Institute For Evolutionary Biology in Leipzig, Germany discovered fossils of Homo sapiens much older than 200,000 years old. The latest dating estimates indicate that
the age of the Jebel Irhoud fossils in Morocco are over 300,000 years old!
I discuss this rather amazing discovery in detail. See Section C sub-heading
ARE MODERN HUMANS MUCH OLDER THAN 200,000 YEARS OLD?
DiD You Know That?
While Mungo Man (60,000 years ago) was undoubtedly fully modern anatomically, he came from a genetic lineage
that is now extinct today. This is because the
mitochondrial DNA extracted from Mungo Man is totally different from mitochondrial DNA
found in modern humans today as well as the Australian aborigines (first arrived 40,000 to 50,000 years ago).
Only faraway North and South America and
All these several Homo species would soon become extinct, due to
200,000 years ago, new arrival suddenly turns up and leads the extinction of all the earlier homo species.
Put simply, Homo erectus, Homo ergaster, Homo heidelbergensis, Homo neanderthalis, Homo floresiensis
and the Denisovans, who had all been minding their own business, are all no match for this new arrival.
What is the name of this new arrival?
Anatomically Modern Humans or archaic Homo sapiens.
Homo erectus, Homo ergaster, Homo heidelbergensis all became extinct
a few thousand years after Anatomically Modern Man arrived 200,000 years ago. Scientists estimate that Homo erectus survived up to 36,000 years ago in Asia but went extinct much earlier in Africa. The Hobbits (Homo floresiensis) died out 12,000 years ago, the
Neanderthals (Homo neanderthalis) went extinct about 39,000 years ago. The Denisovans disappeared roughly 25,000 years ago, leaving just
Anatomically Modern Man or Homo sapiens as the sole homo species alive today.
The human journey began with the
Ardipithecine and Australopithecine hominids 7 million years ago and ended 200,000 years ago. Now that I
have explained extensively how our early human ancestors evolved into modern humans: all of us today!,
I now continue the story of how modern humans left Africa and went onto to eventually populate the rest of the world except Antartica in the South Pole.
SECTION C: ANATOMICALLY MODERN HUMANS (Archaic Homo sapiens) ARRIVE
A list of some of the important Archaic Homo sapiens fossils
discovered all over the world except in the 
About 200,000 to 300,000 years ago, while in
Likewise Modern Homo sapiens or just Homo sapiens are termed Later Modern Humans or
Later Anatomically Modern Humans.
This brings up an important fact: While Homo heidelbergensis living in Europe and Asia
evolved into the
Neanderthals and the Denisovans circa 350,000 to 400,000 years ago respectively. In Africa, Homo heidelbergensis
evolved into
archaic Homo sapiens about 200,000 years ago.
When archaic Homo sapiens moved into Europe, e.g. as the early Cro-Magnons (45,000 to 50,000 years ago) and Asia (70,000 years ago), respectively they encountered the Neanderthals and the Denisovans.
They went on to drive both the Neanderthals and the Denisovans into extinction, but not before some form of interbreeding took place.
Today 6% of Melanesians and 2 to 4% of Europeans and Western Asians have respectively
Denisovan and Neanderthal genes.
2014 science journal, reports that actually more than 4% of Eurasia populations today have Neanderthal DNA.
A lot more sexual encounters between Neanderthals and ancient modern humans took place.
The Northern Route (125,000 years ago ) and the Southern Route (70,000 years ago)
Although Anatomically Modern Humans evolved 200,000 years ago, it was several thousands of years before any migration out of Africa was attempted.
Today the majority of scientists agree there were two major migrations out of Africa.
Both migrations out of Africa took different routes (see world map below), causing scientists to theorise on the evolution of
archaic Homo sapiens and modern Homo sapiens.
The reasons why we have the terms archaic Homo sapiens and modern Homo sapiens is because while
archaic Homo sapiens or Earlier Anatomicaly Modern Humans in Africa dates from 195,000 years to 160,000 years ago (i.e. the Omo Kibish fossils
and Herto man fossils),
Modern Homo sapiens or Later Anatomicaly Modern Humans first appears much later from about 90,000 years ago in Africa. Archaic literally means "old" or "ancient"
Early Modern Humans (i.e. archaic Homo sapiens), evolved first and migrated out of Africa,
before today's modern humans (sometimes called Later Modern Humans).
BREAKING NEWS: In September 2016, the journal Nature reported that three major independent genetics studies in U.S. and European labs led by Dr Eske Willerslev, examined the nuclear DNA of 787 people
from different ethnic groups
around the world. The studies revealed that anatomically modern humans actually left Africa between 50,000 to 80,000 years ago and not the avearge date of 70,000 years ago.
And the migration was via one single dispersal, and not multiple dispersals. Among the different ethnic groups whose DNA was analysed were Australian Aboriginals, Sherpas of Nepal,
North African Bedouins, Cree Native American Indians, Mayans of South America, Europeans, Han Chinese and West Africans.
Fact 1.
Archaeological and later DNA evidence shows that archaic Homo sapiens or Early Modern Humans left Africa
for Asia 125,000 years ago, via the Northern Route from east Africa to Egypt, then entered Israel via the Sinai
as seen in the Skhul and Qafzeh fossils (Israel, which are dated 120,000 years ago), and "possibly" reached Australia due to the
famous 60,000 year old Mungo Man fossils. Another evidence of Early Modern Humans reaching Australia is the
fact that the earliest known evidence of human occupation in Australia is a rock shelter in the Northern Territory that is about 55,000 years old. But most anthropologists agree archaic Homo sapiens
migration out of Africa was largely not a success. Actually some scientists do
disagree that archaic Homo sapiens ever reached Australia, and argue
that archaic Homo sapiens only reached as far as Israel!
They argue that there was no archaic Homo sapiens migration beyond Israel! In other words, the ancient early anatomically modern humans who left the Skhul and Qafzeh fossils and elsewhere perished and no
descendants are around today. Everyone today in Asia, Europe and the Americas, are decendants of the next migration out of Africa: The Southern Route (discussed below).
But there is a problem with this argument:
if archaic Homo sapiens never reached Australia, then how on earth do you explain the 60,000 year old Mungo Man fossils found in Australia??
It shoud be pointed out that Mungo Man is a good example of early anatomically modern humans.
BREAKING NEWS
The Skhul and Qafzeh fossils in Israel, 120,000 years old and Jebel Faya fossils in the United Arab Emirates, 125,000 years old are no longer the
the oldest archaic Homo sapiens discovered outside Africa. In January 2018, stunned Israeli and American scientists announced that archaic Homo sapiens
fossils found in caves at Mount Camel in Israel, are now the oldest archaic Homo sapiens discovered outside Africa. Dating tests show that
the fossils are at least 177,000 to 194,000 years old. Meanwhile
the Jebel Irhoud fossils in Morocco, 300,000 years old remain the oldest archaic Homo sapiens fossils in the world.
In-between 1987 (when Mitochondrial Eve was discovered) and 2016
molecular genetics supported the scientific view that anatomically-modern humans evolved some 200,000 years ago. But in 2017,
spectacular new fossils of modern humans such as Jebel Irhoud fossils in Morocco revised the earliest date modern humans first evolved as 300,000 years ago and not 200,000 years ago.
This also means the age of the Northern Route must now be revised from 125,000 years ago to at least 199,000 years ago!!
BREAKING NEWS
In February 2018 issue of the British Journal Nature, excited researchers in India and Germany announced yet more amazing ancient modern human facts: on the
basis of advanced stone tools
made by ancient humans discovered in India that have been dated as 385,000 years old, it looks like the current (from 2017) scientific
view that anatomically-modern humans evolved some 300,000 years ago, might have to be revised yet again! But the Indian and German scientists are
very cautious, because the stone tools kind of resemble Neanderthal tools in some ways. So it is early days, as more studies need to be done on the stone tools.
BREAKING NEWS:
In July 2017, the respected journal Nature reported that scientists in Australia have discovered artefacts left over
by the Aboriginals of Australia seem to indicate that the Aboriginals of Australia arrived there
much earlier than the 40,000 to 50,000 years ago. Preliminary dating suggests that the Aboriginals
arrived Australia about 65,000 years ago.
NEW UPDATED DATA:
There is more compelling evidence that archaic Homo sapiens or early anatomically modern humans did actually reach Australia and nearby areas.
In September 2016, the journal Nature
reported that three major independent genetics studies in U.S. and European labs led by Dr Eske Willerslev,
examined the nuclear DNA of 787 people from different ethnic groups around the world. The studies revealed that anatomically modern
humans actually left Africa between 50,000 to 80,000 years ago and not the avearge date of 70,000 years ago. However they also discovered that the DNA of
about 2% of Papua New Guinea natives today, showed evidence that their ancestors had arrived much earlier than 70,000 years ago, but around the time of the first
wave of archaic Homo sapiens or Early Modern Humans left Africa
about 125,000 yeats ago. So belonged to the same genetic line as the Skhul and Qafzeh fossils.
And amazingly these ancestors of today's Papua New Guineans took the Southern Route, not the Northern Route!
Professor Chris Stringer (U.K. Natural History Museum) has calculated that for anatomically modern humans in
Africa to have reached Australia 60,000 years ago (i.e. Mungo Man fossils), they had to travel only one mile each year for next
10,000 years to reach Australia, having left Africa about 85,000 years ago. So maybe, we just should not exclude no archaic Homo sapiens migration to Australia yet.
Australia (Mungo Man fossils) was populated up to 10,000 years before Europe. This was possible because early humans migrating from Africa
avoided the colder regions of the North favouring the warmer tropical regions to which they were adapted given their African homeland.
Comparison of the Mitochondrial DNA of ancient and modern Australian Aboriginals (first arrived 40,000 to 50,000 years ago)
with Mungo Man Mitochondrial DNA (60,000 years ago) indicated that Mungo Man fossils are not related to Australian Aboriginals.
It appears that the Aboriginals (Homo sapiens) who arrived Australia at least 48,000 years ago
completely replaced (with no interbreeding) any surviving
Mungo Man descendants who had earlier arrived Australia 60,000 years ago. Meanwhile, although
Mungo Man was undoubtedly fully modern anatomically, he came from a genetic lineage that is now extinct. This is because the
mitochondrial DNA extracted from Mungo Man is totally different from mitochondrial DNA found in modern humans today as well as the Australian aborigines.
NEW UPDATED DATA
In 2010, the Jebel Faya fossils were discovered at the barren desert parts of United Arab Emirates.
and date 125,000 years ago, so about 5,000 years older than the Skhul and Qafzeh fossils of Israel.
The location of this amazing fossil find is also a huge boost to the disputed theories of the Northern Route migration of modern humans via the Sahara Desert, the Sinai then onto Israel and Saudi Arabia.
BREAKING NEWS: In October 2015, scientists announced that when early Anatomically Modern Humans migrated out of Africa for the 1st time circa 125,000 years ago,
they reached ancient pre-historic China around 100,000 years ago! This means that after reaching the Middle East 125,000 years ago, early Anatomically
Modern Humans continued to migrate eastwards reaching
China 100,000 years ago. The fossils in China were discovered in Daoxian County in Hunan Province by Drs Maria Martinon-Torres,
Dr Jose Maria Bermudez, Dr Wu Liu and Dr
Xie-jie Wu. Hunan province is viewed as the cradle of Chinese civilisations and
also the place were Chinese ideographic writing system started.
One final note: The Northern Route was also the route taken by Homo erectus 1.8 million years ago
(as mentioned earlier in this ebook) as they first migrated from Kenya onto Egypt then into Israel, before moving on to, Spain,
Georgia, Indonesia
and China where the best Homo erectus fossils were discovered, (more details on this is at the Homo erectus segment at Section B). The Sahara Desert was not
a desert back then, but an area with lush vegetation and small lakes. So it was very easy for Homo erectus
in Kenya to reach Egypt via the huge area that is today the hot and dry Sahara Desert.
Archaic Homo sapiens DID NOT reach the Americas, that was one continent that was still uninhabited by anyone for over two
millions of years, from the time of Homo habilis and Homo erectus
Fact 2.
Archaeological and later DNA evidence shows that Modern Homo sapiens or Later Modern Humans left Africa for Asia via the Southern Route via the Bab al-Mandab or Bab al-Mandeb strait into Yemen
70,000 years ago. Along the way they replaced any surviving
archaic Homo sapiens because archaic Homo sapiens was not a successful migration,
and in many parts world they reached, they perished as seen in the fate of the Earlier Anatomically
Modern Human Skhul and Qafzeh fossils found in Israel.
Homo sapiens first reached the Middle East from Africa 70,000 years ago. Few Later Anatomically Modern Human fossils
have been found in the Middle East, but in 2008 Israeli anthropologists announced the discovery of the earliest
Later Anatomically Modern Human fossils found outside Africa at the Dan David Manot Caves dating at least 60,000 years old.
Central Asia and beyond was reached from 55,000 years ago as seen in the following fascinating ancient indigenous people today:
the
Aboriginals (Australia); the Orang asli and Semang (Malaysia); the Sentinelese (Andaman Islands and Nicobar Islands); the Maniq
(Thailand); and finally the Aeta or the Ayta (the Philippines).
NEW UPDATED DATA
Aside from the 45,000 year old Niah caves fossils (Sarawak, Malaysia),
the notable absence of fossil evidence for modern human occupation in mainland Southeast Asia,
is due to the fact that fossils do not survive well in the warm, tropical region of eastern Asia.
However in 2012, scientists announced the results of a 2009 fossil find in northern Laos. Professor
Laura Lynn Shackelford, a paleoanthropologist at the University of
Illinois, revealed that the 2009 fossils discovered in a limestone cave,
located in Tam Pa Ling, at the top of the Pa Hang Mountain 3,840 feet (1,170 meters) above sea level,
were dated 58,000 to 63,000 years old!
They are the oldest later anatomically modern human fossils found in Southeast Asia.
Finally Modern Homo sapiens reached Europe at least 45,000 years ago (early and later Cro-Magnons)
and the Americas 20,000 years ago. Cro-Magnons are the earliest known form of anatomically modern humans found in Europe, dating from about 45,000 years ago.
NEW UPDATED DATA
While most paleoanthropology books agree that all modern humans today, outside Africa, are descended from early migrations of Later Anatomically Modern Humans out of Africa via the
Southern Route (i.e. via the Bab al-Mandab or Bab al-Mandeb strait into Yemen), in May 2015, scientists at the
University of Cambridge in Britain led by Dr Luca Pagani published the results of a research project in the
American Journal of Human Genetics , theorising that Later Anatomically Modern Humans
also migrated via the Northern Route via Egypt. But these migrations were the ancestors of only Western Eurasians, because
the majority of Asians as well as the first people of the Americas
descended from Southern Route migrations. Not every one agrees. To his doubters, Dr Pagani said that their teams
work is not in conflict with the accepted Southern Route migrations, agreeing that numerous independent worldwide Y-DNA and Mitochondrial DNA studies
indicate that earlier Southern Route migrations across the strait of Bal el Mandeb to the Arabian Peninsula (i.e. Yemen), did occur.
What about The Americas?
Unfortunately the Americas was not visited by archaic Homo sapiens or early anatomically modern humans. The new world was separated from the old world (Europe, Africa and Asia) by the vast Atlantic and Pacific oceans.
It was only 28,000 years ago, that later anatomically modern humans in East Asia (eastern Russia) were able to cross
the Bering Straits for the first time (using then frozen land bridge known as Beringia) to populate the North America
as descendants of the North American (U.S. and Canada) Native American Indians, and the Mayas of Mexico. South America was reached about circa
15,000 years ago, while the southern tip of South America was finally reached by 9,000 BC. No attempt was made to reach Antartica from the tip of South America.
How Long Did It Take Anatomically Modern Humans to reach all parts of the Globe from Africa ?
From 200,000 to 300,000 years ago, later anatomically modern man evolved in Africa later migrated to Asia for a 2nd time about 70,000 years ago,
Europe 45,000 years ago and the Americas 28,000 years ago. Scientists have calculated that anatomically modern man only
needed to walk 3 miles every 5 years to eventually reach all parts of the globe except Antartica (which is the only continent with
no indigenous population). Bear in mind that anatomically modern humans were hunter-gatherers
moving from place to place every few hours (nomadic lifestyle) and only settled down 10,000 years ago.
Why Was There More than One Migration of Anatomically Modern Humans Out of Africa?
The strong reasons why it is agreed that modern Homo sapiens left Africa much
later than archaic Homo sapiens was because of an important discovery by Professor Alan Templeton, whose important contribution pointed
out the evidence for a series of migrations by modern Homo sapiens known as
Out of Africa Again and Again.
Professor Templeton (Washington University, St Louis) is suggesting there were three such Southern Route migrations and not just a single Southern Route migration.
Each modern Homo sapiens migration wiped out existing populations of homo sapiens, and the last migration was 70,000 years ago.
Likewise there were many Northern Route migrations, unfortunately, most were not successful.
2006 scientific journal reporting on the news that
recent analysis shows three human migrations out of Africa via the Southern Route
NEW UPDATED DATA
When Anatomically Modern Humans migrated out of Africa, they encountered the Neanderthals in Eurasia, and the Denisovans as well as the remaining surviving hobbits in eastern Asia. But in December
2015, scientists claim there was a 3rd type of non-Anatomicaly Modern Humans were around as well: The Red Deer Cave People or the Maludong. It appears these
mysterious non-Anatomicaly Modern Humans evolved during the last great Ice Age.
Red Deer Cave People fossils were first found in the Red Deer Cave Cave in China in 2015, but it later transpired that another set of
Red Deer Cave People fossils had been discovered back in 1991. It appears that like the Hobbits or Homo floresiensis
of Indonesia, the Red Deer Cave People are possibly
another east Asian version of Homo erectus or Homo heidelbergensis that survived until about 15,000 years ago. Some scientists claim that Red Deer Cave People
are hybrid versions of Homo heidelbergensis that mated with Anatomicaly Modern Humans.
The above diagram shows the fossil evidence for Early Modern Humans (i.e. archaic Homo sapiens) and
Later Modern Humans (i.e. homo sapiens ). Both are respectively abbreviated as Earlier AMH for Early Anatomically Modern Humans and Later AMH for
Later Anatomically Modern Humans. Fossil evidence for Early Modern Humans are Omo Kibish and Herto fossils (in Africa)
dated 195,000 to 160,000 years old, and Skhul & Qafzeh fossils (outside Africa, in Israel) dated 120,000 to 90,000 years old.
The gigantic Toba Volcanic Eruption (discussed later in this ebook) occurs 74,000 years ago (more than 80% of early anatomically Modern Humans went extinct during the eruption). Thereafter circa 70,000 years ago,
Later Modern Humans leave Africa (for the last time) for Asia and Europe, replacing or interbreeding
with Early Modern Humans who had survived the Toba Eruption. Thus these facts are clear evidence of the
distinction between archaic Homo sapiens and modern Homo sapiens.
The Singa fossils shown in the diagram above, were archaic Homo sapiens remains
discovered in 1924, in Sudan and date 155,000 years old.
The Taramsa fossils shown in the diagram above, were middle Palaeolithic remains
of archaic Homo sapiens discovered in Egypt and dated 80,000 years ago (just before the Mount Toba eruption).
They are the youngest
archaic Homo sapiens fossils discovered in Africa.
BREAKING NEWS: In early June 2017, excited scientists discovered further proof of Professor Chris Stringer amazing prediction that
the lineage that led to anatomically modern humans might well be over
at least 250,000 years old and not 200,000 years old as previously accepted by scientists (i.e. Omo Kibish fossils in Ethiopia). In Morocco, a team led by anthropologist Dr Jean-Jacques Hublin at the Max
Planck Institute For Evolutionary Biology in Leipzig, Germany discovered fossils of Homo sapiens much older than 200,000 years old. The latest dating estimates indicate that
the age of the Jebel Irhoud fossils in Morocco are over 300,000 years old!
I discuss this rather amazing discovery in detail. See Section C sub-heading
ARE MODERN HUMANS MUCH OLDER THAN 200,000 YEARS OLD?
The above diagram shows the Northern Route taken by
archaic Homo sapiens from East Africa via the Sinai into Israel 120,000 years ago
and shows the Southern Route taken by
Homo sapiens from East Africa via the Bab al-Mandab or Bab al-Mandeb strait into Yemen 70,000 years ago.
However while some paleoanthropology books make a distinction between archaic Homo sapiens and Homo sapiens, SOME do not and use the term
"modern humans" or just "Homo sapiens", as in the quote: "Modern humans Homo sapiens first evolved 200,000 years ago in Africa" (i.e. referring to the Omo Kibish fossils as modern humans and not archaic modern humans).
Either way of definition is accepted by the majority of scientists,
because it is sometimes difficult to classify a human fossil dating from 120,000 years ago,
due to a mixture of BOTH modern and archaic features that may occur. This ebook will make
a distinction between archaic Homo sapiens and Homo sapiens.
Before 2005, the oldest discovery of archaic Homo sapiens
Humans Begin to Wear Clothes for the First Time
About 170,000 years ago, around the time the Neanderthals existed, archaic Homo sapiens humans living Africa started wearing clothes. This culture of wearing clothes was soon picked up by the Neanderthals who crossed paths with the European Homo sapiens (i.e. the early Cro-Magnons) 30,000 to 50,000 years ago.
Prior to that all species of Homo from
Homo habilis to Homo heidelbergensis went about butt naked.
Why and When Did Humans Lose All Their Body Fur Except on the Head?
Scientists have finally figured out why genes controlling excessive thick hair growth on the body other than the head
in humans is switched off (has been deactivated over 1 million years ago), so humans have no body furs
compared to chimpanzees. In the absence of furs, humans have just thin hairs on the body, in particular males
on the chest, legs and arms. The EDA gene is what controls how much fur a mammal has. The Human EDA gene is switched off during the embryo stage, but the gene is fully active on skin cells on the head of embryos, so we are born with no furs, but later on we develop a nice fur on the head.
A mutation in the human gene called KRTHAP1 that codes for keratin (the essential protein that makes human hair structure) caused
the thinning of all remaining human body hair, except on the head! People with far too much body hair have a genetic defect in the KRTHAP1 gene and not the
EDA gene switched on!
But why did humans lose all their body fur except on the head?
Two good sources among others provide full answers: Before the Dawn:
Recovering the Lost History
of Our Ancestors by Nicholas Wade, and Dr Alan Rodgers (in the journal article:
Alan R. Rogers, David Iltis, and Stephen Wooding, Genetic Variation at the MC1R Locus
and the Time Since Loss of Human Body Hair, Current Anthropology
Vol. 45, No. 1, February 2004, pp. 105-108).
Both sources agree that based on calculating mutations
in the MC1R gene, humans had previously lost all their natural body fur-like hair about 1.5 million years ago when
humans existed as Homo ergaster in Africa or as Homo erectus in Asia. These human ancestors
had lost their natural body fur (except on the head), to keep cool after moving
to live in open hot and dry savannah areas. Following this migration into savannah areas Humans evolved to control their body temperature once moving into
open savannah, by sweating. Body sweating is only efficient, if there are no furs on the body (thick hair on heads of all humans
was left there to protect it from over exposure to the sun). If humans had not lost their
body furs, then during very hot weather periods we would have to pant a lot, with our tongues sticking out
like dogs or lions do during hot and dry spells of afternoon sunshine. Humans are not the only few rare examples of
mammals without fur:
pigs, hippos, rhinos, elephants and whales are a few rare examples of mammals without body fur, but they lost their fur for completely
different reasons. For instance hippos and whales
lost theirs, because of their love for spending so much time playing and resting in water and evolution doing the
right thing by making them fur-less. Most animals with lots of fur, such as dogs and cats hate water by
the way for obvious reasons! On
YouTube are lots of hilarious video compilations of dogs and cats stubbornly refusing to be given a
bath. If I got soaked in water wearing a thick coat, suit, shirt, vest etc I would want
to take em all off pronto for dry clothes, dogs and cats can't since their fur is stuck on them permanently. However evolution gave mammals with body fur an ace card for wet situations: these mammals can quickly twist and shake their bodies vigorously to kinda dry themselves quickly with no towels!
Lice Provides Hidden Clues on When Humans Began to Wear Clothes
Delicate studies
of human lice, was what determined what period of time humans began wearing clothes. It was a struck of genius that caused a scientist to ponder if lice could tell us when humans began to wear clothes.
According to the Discovery Report in January 2011, the journal named Molecular Biology and Evolution mentions that Dr David Reed, a mammalogist at the University of Florida, studies lice in modern humans to better understand human evolution and migration patterns.
His research shows archaic Homo sapiens humans started wearing clothes about 70,000 years before leaving Africa and migrating into colder climates and higher latitudes, which began about 100,000 years ago. Therefore
170,000 years ago, archaic Homo sapiens humans started wearing clothes. Pinpointing this date would have been virtually impossible to determine using archaeological data because early clothing would not survive in archaeological sites.
So he devised a project using DNA sequencing to calculate when clothing lice first began to diverge genetically from human head lice. Because they are so well adapted to clothing, we know that body lice or clothing lice almost certainly didn't exist until clothing was invented by humans.
Dr Reed used DNA molecular clocks calculations to pinpoint that 170,000 years ago is the most accurate date. When scientists want to date a biological matter or lifeforms for were no fossils exists except DNA, they use the technique known as DNA Molecular Clock.
This technique measures the average rate at which species genome accumulates mutations, to measure their evolutionary divergence and in other calculations.
In 2003, also using lice and DNA Molecular Clocks, Dr Mark Stoneking a geneticist at the Max Planck Institute For Evolutionary Biology in Leipzig,
Germany, (who co-discovered Mitochondrial Eve using DNA Molecular Clock back in 1987 alongside his colleagues Rebecca Cann and
Alan Wilson at the University of California, Berkeley) estimated humans first began wearing clothes much later in time, about 107,000 years ago.
In 2005, Dr John Fleagle and
other researchers via sophisticated radio argon dating determined that Omo Kibish fossils were an astonishing 195,000 years old, very much
older than Herto skulls. The Omo Kibbish skulls called Omo I and Omo II, were
discovered way back in 1967 by Dr Richard Leakey, near the
You can read about Richard Leakey's discovery of the Omo Kibish skulls from this journal source:
Early Homo sapiens Remains from the Omo River Region of South west Ethiopia, Nature magazine, vol 222, 1132-1133, June 1969.
BBC Report on the Omo Kibbish fossils correctly dated
In the first episode of TV documentary The Incredible Human Journey (a five-episode enjoyable science documentary) presented by Dr Alice Roberts,
first broadcast on BBC TV in 2009, Dr Roberts is seen standing
at the very place at Omo Kibbish, were in 1967 by Richard Leakey discovered the 195,000 year old Omo Kibbish skulls, the oldest anatomically modern human remains ever discovered. With Mitochondrial DNA showing that Mitochondrial Eve dates back at least 200,000 years ago and fossils showing the oldest anatomically human fossil is 195,000 years old, scientists universally agree that modern humans date from 200,000 to 300,000 years ago.
BREAKING NEWS: In early June 2017, excited scientists discovered further proof of Professor Chris Stringer amazing prediction that
the lineage that led to anatomically modern humans might well be over
at least 250,000 years old and not 200,000 years old as previously accepted by scientists (i.e. Omo Kibish fossils in Ethiopia). In Morocco, a team led by anthropologist Dr Jean-Jacques Hublin at the Max
Planck Institute For Evolutionary Biology in Leipzig, Germany discovered fossils of Homo sapiens much older than 200,000 years old. The latest dating estimates indicate that
the age of the Jebel Irhoud fossils in Morocco are over 300,000 years old!
I discuss this rather amazing discovery in detail. See Section C sub-heading
"ARE MODERN HUMANS MUCH OLDER THAN 200,000 YEARS OLD?"
What’s So Special About the Omo Valley anyway?
The Omo Valley borders northern Kenya and southern Ethiopia, so it shares area in both countries. The Omo Kibish fossils were found in the Ethiopian part of the Omo Valley. The Omo River, approximately 400 miles long, runs through the Omo Valley from north to south. It drains into Lake Turkana just inside the Kenyan border. People living in the Omo Valley include traditional pastoralists, herders, and subsistence agriculturalists. The Omo Valley forms part of the Great Rift Valley of East Africa as shown in the map below.
The Great Rift Valley above, is a geographical and geological
feature running north to south for around 4,000 miles (6,400 kilometers), from northern Syria to central Mozambique in East Africa. Astronauts and cosmonauts on board the International Space Station
say it is the most significant natural physical detail on the planet that is visible from outer space.
The most significant man-made physical detail on the planet that is visible from outer space is of course The Great Wall of China!
In Africa, the terrain ranges from salt flats more than 500 feet (152 meters) below sea level to towering, snow-capped mountains. The Rift is known for its spectacular scenery and abundant, sometimes unique, wildlife. A series of some thirty lakes lies along its length; the three largest in Africa are known as the Great Lakes and include Lake Tanganyika, the second deepest lake in the world, and Lake Victoria, the second-largest freshwater lake by surface area in the world. Some of the oldest remains of ancestral humans have been found in in the African segment of the valley.
The Great Rift Valley is thus a special for anthropologists because it has been and is still a rich source of both hominid and early human fossils that allow the study of human evolution. According to Wikipedia, the rapidly eroding highlands quickly filled the valley with sediments, creating a very favourable environment for the preservation of ancient human and hominid remains. With this in mind, it is easy to why the discovery in 1967 at the Omo Valley was special.
Have a closer look at the map above to see something rather extraordinary: To the north of the Great Rift Valley in Ethiopia we see Danakil Depression (i.e. Lac Assal, a lake),
which is the lowest point in Africa. It is so deep that just glancing below, from the
very edge of the Danakil Depression is frightening. The Danakil Depression is also the hottest
place on the planet. Meanwhile to the south of the Great Rift Valley in Kenya we see the gigantic
Mount Kilimanjaro, which is the highest point in Africa.
It is the highest “free-standing” mountain in the world. A "free-standing" mountain is a mountain on sea level, meaning it is not in a mountain range, e.g. Mount Everest is in the Himalayas mountain range, so not a free-standing mountain.
In the final analysis, the Omo Kibish skulls have a prominent place in the history of human evolution,
along side Lucy, Homo habilis and Homo erectus.
ARE MODERN HUMANS MUCH OLDER THAN 200,000 YEARS OLD?
I began Section C by noting that about 200,000 to 300,000 years ago, while in Africa,
a group of Homo heidelbergensis species and maybe some Homo ergaster species as well,
evolved over a long period of time into the closest we have of the archaic Homo sapiens.
Modern human’s scientific term is Homo sapiens, or just Homo sapiens And the earliest versions of modern humans
are termed archaic Homo sapiens OR Early Modern Humans OR Early Anatomically Modern Humans. The date 200,000 was well established in the late 1970s and 1980s from
fossil evidence and Mitocohndial DNA evidence (See Scection E).
But since then scientists are starting to have doubts. Two headlines were made in 2016 and 2017, shown below indicate "200,000" years
old as the age when modern humans firsr appeared might not be exactly correct.
BREAKING NEWS
The Skhul and Qafzeh fossils in Israel, 120,000 years old and Jebel Faya fossils in the United Arab Emirates, 125,000 years old are no longer the
the oldest archaic Homo sapiens discovered outside Africa. In January 2018, stunned Israeli and American scientists announced that archaic Homo sapiens
fossils found in caves at Mount Camel in Israel, are now the oldest archaic Homo sapiens discovered outside Africa. Dating tests show that
the fossils are at least 177,000 to 194,000 years old. Meanwhile
the Jebel Irhoud fossils in Morocco, 300,000 years old remain the oldest archaic Homo sapiens fossils in the world.
In-between 1987 (when Mitochondrial Eve was discovered) and 2016
molecular genetics supported the scientific view that anatomically-modern humans evolved some 200,000 years ago. But in 2017,
spectacular new fossils of modern humans such as Jebel Irhoud fossils in Morocco revised the earliest date modern humans first evolved as 300,000 years ago and not 200,000 years ago.
This also means the age of the Northern Route (discussed earlier on in Section C) must now be revised from 125,000 years ago to at least 199,000 years ago!!
BREAKING NEWS
In February 2018 issue of the British Journal Nature, excited researchers in India and Germany announced yet more amazing ancient modern human facts: on the
basis of advanced stone tools
made by ancient humans discovered in India that have been dated as 385,000 years old, it looks like the current (from 2017) scientific
view that anatomically-modern humans evolved some 300,000 years ago, might have to be revised yet again! But the Indian and German scientists are
very cautious, because the stone tools kind of resemble Neanderthal tools in some ways. So it is early days, as more studies need to be done on the stone tools.
BREAKING NEWS: In early August 2016, Professor Chris Stringer, Britain's leading paleoanthropologist, presented a
research paper to the journal Philosophical Transactions in which he theorises that the lineage that led to anatomically modern humans must be at least be
250,000 years to 500,000 300,000 years old and not 200,000 years old.
He predicts that one day paleoanthropologists will discover more important ealier anatomically modern humans fossils that are older than 200,000 years old.
Stringer cites the evidence of the mysterious Florisbad fossils or Homo helmei and other similar fossils
which are anatomically modern human and are much older than 200,000 years old.
BREAKING NEWS: In early June 2017, the Journal Nature reported that excited scientists had discovered further proof of Professor Chris Stringer
amazing prediction that the lineage that led to anatomically modern humans might well be over at least 250,000 years to 500,000 years
old and not avearge 200,000 years old as previously accepted by the majority of scientists today. In Morocco, a team led by anthropologist Dr Jean-Jacques Hublin
at the Max Planck Institute For Evolutionary Biology in Leipzig, Germany discovered fossils of Homo sapiens much older than 200,000 years old.
This discovery was so significant and ground-breaking that that several mainstream media such as the website for The Wall Street
Journal at http://www.wsj.com for June 7th
which normally deals with business and finacial news, mention the fantastic discovery!
Dr Jean-Jacques Hublin notes that the accurately fossils were dated at about 310,000 years old. They have all the anthropological
features that classify them as anatomically modern humans. Other prominent scientists such as Dr John Fleagle of Stony Brook School of Medicine agrees
it is anatomically modern humans albiet with some rather primitive features as well.
The fossils were discovered in the Sahara Desert portion of Morocco, this place was not a desert 300,000
years ago but a region of lush green vegetation everywhere and many ancient humans living there alongside ancient animals as well. The fossils were discovered at
a place in the Sahara Desert part of Morocco called
the Jebel Irhoud (a few miles south of Marrakesh). This site years earlier had previously yielded other similar human fossils dated at 210,000 years old.
In the 1990s the site also yielded
human fossils dated at over 150,000 years old.
So the question now is, are modern humans indeed much older than 200,000 years old?
Let us first of all take a good look at two earlier mysteries (one in 1932 and one in 2013) that make us ask this question againand again.
The Mystery of the Florisbad Fossils and Mr Albert Perry's Very Ancient DNA
In 1932, near the city of Bloemfontein, South Africa, zoology Professor T. F. Dreyer stumbled upon the so-called Florisbad fossils,
and was later dated as circa 259,000 years old. There was a nagging problem with this fossil that puzzled other scientists later in the 1960s and more recently in the 1980s: Florisbad fossils were definitely not anatomically modern human, lacking the several prominent features associated with anatomically modern human. Even more surprising was the fact that the fossils did not seem to have the prominent features of
Homo heidelbergensis, the ancestor of anatomically modern humans and also the last common ancestor of modern humans and Neanderthals. So scientists gave the mysterious Florisbad fossils a new species name: Homo helmei.
Scientists today conclude that Florisbad fossils existed when Homo heidelbergensis was
slowly evolving into anatomically modern human, hence Florisbad fossils had features that were in transition between Homo heidelbergensis and anatomically modern humans. In other words Florisbad fossils are an intermediate form between Homo heidelbergensis and Homo sapiens .
Homo helmei is one of many human species that has failed to gain widespread recognition. Textbooks tend to either mention it only in passing, or not at all!
Homo helmei is discussed in Stephen Oppenheimer's book The Real Eve, Dr Oppenheimer contends that Homo helmei
may be a direct ancestor of Homo sapiens .
As mentioned earlier on, Professor Chris Stringer in his August 2016 Philosophical Transactions article
had theorised that the lineage that led to anatomically modern humans might well be at least between 250,000 years old to 500,000 years old
and not 200,000 years old as previously accepted by scientists.
Professor Stringer predicts that one day paleoanthropologists will discover anatomically modern human fossils in Africa and elsewhere,
that are older than 200,000 years old. On the basis of this theory, we must revisit discovery of
Homo helmei (also called ) made before Professor Stringer prediction and look at the possibility that Homo helmei might be an
a very early version of archaic Homo sapiens . Recall that the Omo Kibish fossils (195,000 years old) were discovered by Dr Richard
Leakey in 1967 in Ethiopia and the theory of Mitochondrial Eve (discussed in detail in Section E)
both put the age of anatomically modern humans as 200,000 years old. Professor Chris Stringer's new theory age of
the age of anatomically modern humans being more than 200,000 years old might prove to be spot on. His theory is helped by the
discovery of fossils (dating over well over 200,000 years old)
belonging to early versions of archaic Homo sapiens such as
Florisbad fossils of South Africa (259,000 years old), as well as others such as the Eliye Springs fossils of Kenya (305,000 years old);
the Jebel Irhoud fossils of Morocco (310,000 years old) and the
the Ndutu fossils of Tanzania (510,000 years old!). Some scientists however argue that one must consider the possibility that these early versions
of archaic Homo sapiens might actually be later versions of Homo heidelbergensis or perhaps fossils with features that were in transition
between Homo heidelbergensis species and anatomically modern humans: fossils showing both physiological characteristics of Homo heidelbergensis and
archaic Homo sapiens . If in the future paleoanthropologists do discover so many more important ealier anatomically modern humans
fossils that are much older than 200,000 years old, perhaps human evolution books may have to be rewritten then!
The Mystery of Albert Perry's Very Ancient DNA
Later on in the final parts of Section E, I will discuss details about the amazing mystery of Mr Albert Perry's very ancient DNA which is
338,000 years old! The age of Mr Perry's DNA is further proof that there are anatomically modern humans (i.e. in this case Mr Albert Perry) that
are older than 200,000 years old.
Basically, Mr Albert Perry was an African American, whose family members out of curiosity in 2013 sent his
DNA for testing to trace his African ancestry, but in doing so, opened a can of worms about the age of anatomocally modern humans.
Recall that the oldest anatomically modern humans and the accepted accurate dating of the Mitochondrial Eve (discussed in detail in Section E)
shows that modern humans only came into existence 200,000 years ago. Scientists concluded that Mr Albert Perry's Y-Chromosome DNA came into existence
when the vast majority of earlier
humans
were at the Homo heidelbergensis stage
in Africa and existed as the Neanderthals in Europe and Western Asia and the Denisovans in Eastern Asia. The problem
is Homo heidelbergensis was not yet anatomically modern human!!
Scientists theorised that just after 200,000 years ago, a group of anatomically modern humans i.e. archaic Homo sapiens
had a chance encounter with a group of surviving Homo heidelbergensis humans (whose normal ancestry went back 338,000 years ago).
This is possible because Homo heidelbergensis did not instantly disappear when anatomically modern humans evolved 200,000 years ago,
instead Homo heidelbergensis was gradually reduced in population numbers over thousands of years competing unsuccessfully with anatomically
modern human for resources such as food and caves for shelter. Soon Homo heidelbergensis became extinct. However the chance encounter did not
end there, some form of mating actually took place during the encounter.
This cross-species mating took place only in Cameroon where the original ancestors of the Mbo people lived.
The result was hybrid or introgression: offspring containing both Homo heidelbergensis genes and anatomically
modern human (archaic Homo sapiens) genes: Albert Perry's ancestral mother is believed to have mated with a male Homo heidelbergensis
and the Y-chromosome DNA has passed down the male line to Albert Perry's ancestors!
Over time, thousands of year later,
natural selection allowed only the modern Mbo people of Cameroon (and some nearby neighbours such as the Bangwa people
and some ethnic groups now in places near the border with Cameroon and Nigeria) to retain some very ancient DNA of Homo heidelbergensis
in their genome, including the ancestors of Mr Albert Perry.
The mention of Nigeria brings up an earlier discovery: in 1971 by a team lead by Dr Thorstan Shaw of the University of
Ibadan made an astonishing discovery. A few hundred miles from the Cameroon border Thorstan Shaw discovered the Iwo Eleru rock shelter in Nigeria,
where excavated ancient human remains suggested that an unknown cousin human species was still living there as recently as 15,000 years ago.
In 2011 using advanced DNA techniques, this unknown cousin human species was theorised to be most probably a human hybrid (offspring containing
both Homo heidelbergensis and anatomically modern human genes). Today we can say with certainty that the people living at
Iwo Eleru rock shelter 15,000 years ago carried the same ancient DNA as Mr Albert Perry. We now know that Albert Perry's DNA belongs to the rare and ancient
Y-Chromosome DNA haplogroup known as the A00 sub-haplogroup. What is a haplogroup? In Section E, I will explain that
from 200,000 years ago when modern humans first emerged, they have gradually but steadily accumulated dozens of variations in the DNA in their
mitochondria (males and females) and
Y-Chromosome (males only).
All these genetic variations have been divided into subunits known today as haplogroups. So
haplogroups are a group of people around the world who share a set of specific genetic markers and therefore a common ancestor.
These specific genetic markers are called SNPs or Single Nucleotide Polymorphisms. More about SNPs and haplogroups is explained in Section E,
but I summarise things below in relation to the age of modern humans.
About 96% of the entire modern African population today carries the major Y-Chromosome DNA haplogroup known as the E haplogroup.
The other 4% of the modern African population today belong to
two very ancient and rare haplogroups: the A and B haplogroups. The A haplogroup is oldest possible haplogroup of humans today anywhere in the world
(over 300,000 years old for the A00 sub-haplogroup and 190,000 years old for the A0 sub-haplogroup). The sub-haplogroups of the A haplogroup
such as A0, A00, A1, and A2, thus all belongs to the following ancient African ethnic groups: the Mbo, Bakola, Bangwa (Western Cameroon),
Kho and San or Khoisan (Kalahari Desert of Namibia, Botswana and South Africa). The full technical name of the A0 hapogroup is L1085 The other very ancient haplogroup, the B haplogroup belongs to the Mbuti and
Biaka Pygmy (Zaire and Central African Republic respectively) and Hadza & Sandawe (Tanzania), as well as some old Kenyan, Sudan (Dinka) and Ugandan ethnic groups,
all found in Central and East Africa. Kho and San in Namibia and South Africa and also carry the B haplogroup as well as the A haplogroup.
The ancestry of the Mbo, Bakola, Bangwa, Kho, San, Mbuti and Biaka Pygmy, Sandawe, Dinka and Hadza ethnic groups are the thus oldest in Africa and the
entire world, as all the ethnic groups carry either or both of the haplogroups A and B, the oldest haplogroups in the world.
Two other common things about these two sets of ancient ethnic groups is that first of all, almost all of them speak an unusual
type of very ancient language known as the Click Languages. Secondly they also have the oldest Mitochondrial DNA haplogroups in the world:
the L0 haplogroup (185,000 years old, for the Kho and San people or Khoisan) and L1 and L2 MtDNA haplogroup (150,000 years old,
for the Hadza, Bakola, Mbo and other ethnic groups mentioned above). You can read more about haplogroups, mitochondrial DNA in detail at Section E.
Recall earlier on that I said: Homo heidelbergensis living in Europe and Asia evolved
into the Neanderthals and the Denisovans circa 350,000 to 400,000 years ago respectively.
In Africa, Homo heidelbergensis evolved into archaic Homo sapiens about 200,000 years ago.
Now, when anatomically modern humans migrated out of Africa for the 1st and the 2nd time (discussed in Section D), they
encountered non-anatomicaly modern humans: the Neanderthals in Eurasia and the Denisovans and Red Deer Cave People or the Maludong in eastern Asia.
Newly arrived anatomically modern humans living in southeast Asia from about 37,000 years ago
interbred on a large scale with some groups of Denisovans passing on their genes to 6% of modern day populations of Melanesians today, such as Solomon Islanders and the Aboriginals of Australia. Likewise
newly arrived anatomically modern humans living in Europe and Western Asia (i.e. Middle East to Northern India and Iran) from about 37,000 years ago
interbred with some groups of Neanderthals passing on their genes to 4% of modern day populations of Europeans and Western Asians today.
It is thus credible that as in the case of Albert Perry, sometime after 200,000 years ago, anatomically modern humans (i.e. archaic Homo sapiens)
living in West Africa
interbred with some surviving groups of Homo heidelbergensis passing on their genes to 2% of modern day populations of
West Africa with the rare and ancient A00 haplogroup such as the Mbo ethnic group in Cameroun today.
Since Y-Chromosome Adam dates back to 208,300 years ago, Albert Perry, and the Mbo / Bangwa ethnic groups
with the same distinct A00 Y chromosome, actually are not descendants of Y-Chromosome Adam, their origins simply push the dawn of
humanity back from 208,300 years ago to 338,000 years ago.
In June 2017, on the bioRxiv server (a popular repository for biological sciences research work papers)
a research paper written by South African ans Swedish scientists led by Drs Mattias Jakobsson,
Carina Schlebusch and Helena Malmstrom at Uppsala University in Sweden and the University of Johannesburg and Witwatersrand
University in South Africa
provides genetic evidence that lineage that led to anatomically modern humans is over 260,000 years old. They had extracted DNA from
a 2,000 year South African male fossil and determined that his ancestors had split from present day African populations in South Africa over 260,000 years ago!
FINAL ANALYSIS
My opinion is that, from all that I have discussed above:
fossil and genetic evidence today DOES indeed prove that the modern humans evolved sometime between at least 200,000 to 300,000 years ago.
1) In early June 2017, excited scientists discovered further proof of Professor Chris Stringer amazing prediction that
the lineage that led to anatomically modern humans might well be over
at least 250,000 years old and not 200,000 years old as previously accepted by scientists (i.e. Omo Kibish fossils in Ethiopia). In Morocco, a team led by anthropologist Dr Jean-Jacques Hublin at the Max
Planck Institute For Evolutionary Biology in Leipzig, Germany discovered fossils of Homo sapiens much older than 200,000 years old.
The latest dating estimates indicate that
the age of the Jebel Irhoud fossils discovered south of Marrakech in Morocco (not shown in the map below) are over 300,000 years old! In the 1990s, several
anatomically modern human fossils were also discovered at Jebel Irhoud, but much younger at 160,000 years old.
2) and 3): The Omo Kibish fossils (195,000 years old) and the Herto Man fossils
(160,000 years old), respectively the 2nd oldest and 3rd oldest official
archaic Homo sapiens discovered, the remaining oldest fossils are briefly cross examined below:
4): The Singa fossils discovered in Sudan (not shown in the map below)
date circa (155,000 years old) and are the 3rd oldest archaic Homo sapiens dug up.
The Singa fossils were discovered in 1924.
6): The Klasies River Mouth fossils
from southern Africa date (118,000 years old) and are the 5th oldest archaic Homo sapiens dug up.
South Africa is also home to the oldest caves used by anatomically modern humans: Pinnacle Point Caves
in Mossel Bay date from 170,000 years ago (Middle Stone Age period). Major research projects such as those by
Professor Curtis Marean from the University of Arizona, are ongoing at the caves.
7) While the oldest archaic Homo sapiens in Africa date from 300,000 to 195,000 years ago,
the oldest archaic Homo sapiens discovered outside Africa is the Skhul and Qafzeh fossils
found in caves in Israel in 1932. They date from (120,000 years ago)
The Border Cave fossils near the Lebombo Mountains in KwaZulu-Natal
near the border between South Africa and Swaziland are just about the same age as the
Skhul and Qafzeh fossils in Israel.
NEW UPDATED DATA
In 2010, the Jebel Faya fossils not shown in the map below, were discovered in the desert regions of the United Arab Emirates.
and date 125,000 years ago, so about 5,000 years older than the Skhul and Qafzeh fossils.
The location of this amazing fossil find is also a huge boost to the theories of the Northern Route migration of modern humans.
BREAKING NEWS
The Skhul and Qafzeh fossils in Israel, 120,000 years old and Jebel Faya fossils in the United Arab Emirates, 125,000 years old are no longer the
the oldest archaic Homo sapiens discovered outside Africa. In January 2018, stunned Israeli and American scientists announced that archaic Homo sapiens
fossils found in caves at Mount Camel in Israel, are now the oldest archaic Homo sapiens discovered outside Africa. Dating tests show that
the fossils are at least 177,000 to 194,000 years old. Meanwhile
the Jebel Irhoud fossils in Morocco, 300,000 years old remain the oldest archaic Homo sapiens fossils in the world.
In-between 1987 (when Mitochondrial Eve was discovered) and 2016
molecular genetics supported the scientific view that anatomically-modern humans evolved some 200,000 years ago. But in 2017,
spectacular new fossils of modern humans such as Jebel Irhoud fossils in Morocco revised the earliest date modern humans first evolved as 300,000 years ago and not 200,000 years ago.
This also means the age of the Northern Route must now be revised from 125,000 years ago to at least 199,000 years ago!!
BREAKING NEWS
In February 2018 issue of the British Journal Nature, excited researchers in India and Germany announced yet more amazing ancient modern human facts: on the
basis of advanced stone tools
made by ancient humans discovered in India that have been dated as 385,000 years old, it looks like the current (from 2017) scientific
view that anatomically-modern humans evolved some 300,000 years ago, might have to be revised yet again! But the Indian and German scientists are
very cautious, because the stone tools kind of resemble Neanderthal tools in some ways. So it is early days, as more studies need to be done on the stone tools.
8)
The Taramsa fossils not shown in the map below,
were middle Palaeolithic remains of archaic Homo sapiens discovered in Egypt and dated (80,000 years old)
, so close to the Mount Toba eruption 74,000 years ago. They are the youngest archaic Homo sapiens fossils
discovered in Africa.
9)
The Mungo Man archaic Homo sapiens fossils discovered near
Lake Mungo in southeast Australia in 1974 by Dr Jim Bowler are (60,000 years old.)
In Laos, located in Tam Pa Ling (not shown on map below),
we come across the Tam Pa Ling fossils dated 63,000 years old.
10)The sites Pestera cu Oase in Romania and Mladec in the Czech Republic,
shown in the diagram below, represents the oldest discovered fossil evidence
of anatomically modern humans found in Europe, both dating
(45,000 years old) and (36,000 years old) respectively.
Pestera cu Oase are the oldest Cro-Magnon fossils to date.
Apparently archaic Homo sapiens may not have reached Europe, as the Cro-Magnons are
classified as Later Anatomically modern Humans and not Earlier Anatomically Modern Humans.
BREAKING NEWS
In 2015, new samples of Cro-Magnon fossils found in Pestera cu Oase in Romania
indicated that Neanderthal genes were present in the fossils in a much higher proportions than previously thought.
Between 11% and 51% of the genes in these newly discovered
Cro-Magnon were Neanderthal genes!! indicating that lots of lusty sexual encounters took place between the
Cro-Magnons and Neanderthals in Romania's Pestera cu Oase from 45,000 years ago.
11)
In east Asia, the oldest archaic Homo sapiens fossils include the (40,000 years old) fossils discovered in the
Xianrendong Caves, in south eastern China. The Zhoukoudian caves in northern China are
(48,000 years old) fossils. Zhoukoudian was also the site of the much older Peking Man
Homo erectus fossils. The 63,000 years old Tam Pa Ling fossils of Laos and the 60,000 years old Mungo man fossils
of Australia
listed in number 9, are the oldest anatomically modern human fossils found in Asia.
The above list is only partial. There are several more less significant African
anatomically modern human fossils that have been discovered,
and the following book is a good text that list most of these fossils and provides comprehensive descriptions of all the fossils: The First Africans: African Archaeology from the Earliest Toolmakers to Most Recent Foragers (Cambridge World Archaeology) by Lawrence Barham and Peter Mitchell.
Having reached this far, covering the appearance of anatomically modern human, all over the Old
World (Africa, Asia and Europe), You might ask yourself why anatomically modern humans are the only
types of humans around today. Why were other types of early humans lost to extinction? Yes there was
fierce competition from anatomically modern humans as I explained earlier on. I also found a lot of
answers in a popular book by Chris Stringer titled: Lone Survivors: How We Came to Be the
Only Humans On Earth. The book is a quite similar to his other popular book
Origin of Our Species Apparently the former is an American edition and the later
is a U.K. only edition.
What about The Americas?
Unfortunately the Americas was not visited by archaic Homo sapiens or Early Anatomically Modern Humans. The new world was separated from the old world (Europe, Africa and Asia) by the vast Atlantic and Pacific oceans.
It was only 28,000 years ago, that Later Anatomically Modern Humans in East Asia (eastern Russia) were able to cross
the Bering Straits for the first time (using then frozen land bridge known as Beringia) to populate uninhabited North America
as descendants of the North American (U.S. and Canada) Native American Indians, and the Mayas of Mexico etc. South America was reached about circa
15,000 years ago, meanwhile the southern tip of South America (e.g. Chile) was finally reached by 9,000 BC.
No attempt was made to reach Antartica from the tip of South America, it was just too cold!!
Among the 4 earliest Later Anatomically Modern Human fossils or Paleo-Indian fossils found in
the Americas are:
a) 13,800 year old so-called Eve of Naharon fossil discovered in the Mexican state of
Quintana Roo. This fossil was a near complete human skeleton, and scientists were able to detect preserved DNA.
b) 13,000 year old female fossil from the Yucatan Peninsula in Mexico, named Naia.
c) 11,500 year-old female fossil remains found in a cave in Lapa Vermelha, Brazil, now called Luzia Woman.
d) 10,800 year old so-called Peńon woman fossil discovered in Mexico.
How Long Did It Take Anatomically Modern Man to reach all parts of the Globe from Africa ?
From 200,000 years, anatomically modern man evolved in Africa later migrated to Asia 70,000 years ago,
Europe 45,000 years ago and the Americas 28,000 years ago. Scientists have calculated that anatomically modern
man only needed to walk 3 miles every 5 years to eventually reach all parts of the globe except Antartica
(which is the only continent with no indigenous population). Professor Chris Stringer (U.K. Natural History Museum in London)
has calculated that for anatomically modern humans in Africa to have reached Australia 60,000 years ago (i.e. Mungo Man fossils),
they only had to travel only one mile each year for next 10,000 years to reach Australia, having left Africa 70,000 years ago.
Bear in mind that anatomically modern humans were hunter-gatherers moving from place to place every few hours (nomadic lifestyle) and only
settled down 12,000 years ago.
A list of some of the important Archaic Homo sapiens fossils
discovered all over the world except in the
Section D: Later Anatomically
Modern Humans evolve then some leave Africa (Upper Paleolithic era)
As discussed previously, with the exception of the Americas, and much of Eurasia, archaic Homo sapiens even managed to reach
far away Australia 60,000 years ago: evidence of this comes from Mungo Man fossils, discovered near Lake Mungo in south east
Australia. Dr Alice Roberts in the BBC TV Series The Incredible Human Journey on ancient Australia notes that
Mungo Man fossil dating of 60,000 years ago, is corroborated by
the fact that the giant kangaroo in Australia (which stood over 15 feet tall!) became extinct
50,000 years, when a brand new predator (humans) began to hunt them in very huge numbers,
as they were the primary source of meat for the new human arrivals.
While we do not know what actually prompted Homo erectus and other earlier human species to leave Africa
in the first place, scientists have postulated that
archaic Homo sapiens and later modern humans were thought to have been possibly forced out of
Africa due to the East African mega-droughts (about 135,750 years ago) during the early late-Pleistocene.
While the
oldest archaic Homo sapiens in Africa
date from 195,000 years ago, the oldest archaic
Homo sapiens discovered outside
Africa were the Skhul and Qafzeh
fossils found in caves in
NEW UPDATED DATA In 2010, the Jebel Faya fossils were discovered at the United Arab Emirates.
and date 125,000 years ago, so about 5,000 years older than the Skhul and Qafzeh fossils.
The location of this amazing fossil find is also a huge boost to the theories of the Northern Route migration of modern humans via the Sahara Desert and the Sinai onto Israel and Saudi Arabia.
BREAKING NEWS
The Skhul and Qafzeh fossils in Israel, 120,000 years old and Jebel Faya fossils in the United Arab Emirates, 125,000 years old are no longer the
the oldest archaic Homo sapiens discovered outside Africa. In January 2018, stunned Israeli and American scientists announced that archaic Homo sapiens
fossils found in caves at Mount Camel in Israel, are now the oldest archaic Homo sapiens discovered outside Africa. Dating tests show that
the fossils are at least 177,000 to 194,000 years old. Meanwhile
the Jebel Irhoud fossils in Morocco, 300,000 years old remain the oldest archaic Homo sapiens fossils in the world.
In-between 1987 (when Mitochondrial Eve was discovered) and 2016
molecular genetics supported the scientific view that anatomically-modern humans evolved some 200,000 years ago. But in 2017,
spectacular new fossils of modern humans such as Jebel Irhoud fossils in Morocco revised the earliest date modern humans first evolved as 300,000 years ago and not 200,000 years ago.
This also means the age of the Northern Route must now be revised from 125,000 years ago to at least 199,000 years ago!!
BREAKING NEWS
In February 2018 issue of the British Journal Nature, excited researchers in India and Germany announced yet more amazing ancient modern human facts: on the
basis of advanced stone tools
made by ancient humans discovered in India that have been dated as 385,000 years old, it looks like the current (from 2017) scientific
view that anatomically-modern humans evolved some 300,000 years ago, might have to be revised yet again! But the Indian and German scientists are
very cautious, because the stone tools kind of resemble Neanderthal tools in some ways. So it is early days, as more studies need to be done on the stone tools.
The sites Pestera
cu Oase in Romania and Mladec in the Czech Republic on the map above represents the oldest discovered fossil evidence Later Anatomically Modern Humans
of Homo sapiens (Cro-Magnon) found in
The Last Migration Out of Africa
Later Anatomically Modern
humans Homo sapiens sapiens
evolved in 
1) Professor Luigi Luca Cavalli-Sforza (Stanford University), a geneticist famous for his 2001 ground-breaking book Genes, Peoples and Languages.
In 1965, when the use of DNA to trace human ancestry was at its infancy, Professor Emeritus Luigi Luca Cavalli-Sforza and his colleagues at Stanford University had used classical
genetical data such as human proteins and blood groups in attempt
to use genetical data on human ancestry research and population genetics projects.
In this case analyses of polymorphisms sites, (i.e. markers or mutations) in proteins and blood groups was carried out.
In the case of DNA analysis, when it finally became available, Cavalli-Sforza again looked
for markers or mutations in Y-Chromosome DNA, known as
SNP or single nucleotide polymorphism sites. SNPs will be discussed in detail later on at the genetics tutorial at Section E.
2) Professor Douglas C Wallace, a geneticist (University of Pennsylvania and Emory University) whose research into human MtDNA
(Mitochondrial DNA) as a genetic marker was first investigated in the middle 1970s
using low-resolution restriction enzyme analysis.
3) Professor Allan Wilson and his PhD students, Dr Rebecca Cann and Dr Mark Stoneking,
University of California, Berkeley. In 1987 they announced to the world media, the discovery of Mitochondrial Eve (who had the oldest MtDNA).
Both Wallace and Wilson are credited for discovering the African L3 MtDNA genetic marker.
All humans today who ancestry is outside Africa have the L3 marker in their genome. Their research work was greatly helped by the earlier discoveries and research
work achieved by
Professor Douglas C Wallace and Professor Luigi Luca Cavalli-Sforza.
4) Dr Peter A. Underhill (Stanford University) is one of the earlier
pioneers of tracing human history through genetic mutations using the male Y-Chromosome DNA, (instead of MtDNA used by the first three above).
He is credited for discovering the African M168 Y-Chromosome DNA genetic marker in the early 1990s.
All humans (males) today who ancestry is outside Africa have the M168 marker in their genome. It is sometimes called Eurasian Adam
the common ancestor of everyone living today outside of Africa.
5) Dr MF Hammer (University of Arizona) is also one of the earlier
pioneers of tracing human history through genetic mutations using Y-Chromosome DNA.
He is credited for discovering the famous African YAP Mutation marker in 1991. This was a very important discovery
and helped scientists understand the migration of humans out of Africa.
Much more detailed genetic maps, as well as a comprehensive look at how molecular genetics explains
human evolution and discussions on Mitochondrial Eve
are all given at the special exciting genetics tutorial: Section E in this ebook very soon just after the discussion
on Mount Toba below. You can use the table of contents (at the beginning of this ebook) to select specific topics from the
genetics tutorial section (which is very comprehensive).
THE MOUNT TOBA SUPER VOLCANO ERUPTION 74,000 YEARS AGO
Modern
humans Homo sapiens sapiens
arrived Asia via the Arabian Peninsula from
NEW UPDATED DATA. Many sources including the book
National Geographic Answer Book: Fast Facts About Our World, 2010,
puts the world population at 70,000 years ago (inside and outside Africa) as more
or less 15,000 people (page 215).
Two fascinating science reports showing the curious fact that humans have very little genetic
diversity compared to other mammals like chimpanzees:
1.
Nearby chimpanzee populations show much greater genetic diversity than distant human populations.
2. Just one group of chimpanzees can have more genetic diversity than all 6 billion humans on the planet.
Put in another way, geneticists tell us (from the results of the expensive 2003 Human Genome Project) that all humans are about 99.9% identical, and thus
differ by just 0.1 % in their DNA (leading to
such diversities such as the human ethnic groups). 0.1% is a huge number in genetics.
0.1% of the 70,000 genes in the human genome are 70 genes. It is these 70 genes that make Europeans, Africans and
Asians different from one another in physical appearance, e.g. skin colour and hair textrure. These 70 genes among other things handle skin colour,
eye colour, hair texture etc, as well as very specific features that make it possible to do
such things as a DNA test to prove whose DNA, a blood or saliva sample
belongs to, as evident in forensic science.
The fact that just 70 genes separates one human from another, shows why
humans today, have very little genetic diversity.
The reason for this little genetic diversity is all too clear:
In the Post-Toba Migration period, approximately 70,000 years ago, the world population
(inside and outside Africa) was estimated as more or less 15,000 people, AND: all closely related to each other.
The
absence of large genetic differences in human population today was in part due to the
human gene pool being reduced to a very small
size in the recent past, thereby wiping out genetic variation between current
populations of the world today.
A recent 2013 Science News report downplaying the Toba eruption:
Science News, May 2013: Eruption early in human prehistory may have been more whimper than bang.
A 2003 Journal of Human Evolution article (45, 227-230), supporting the Toba eruption:
The super-eruption of Toba, did it cause a human
bottleneck?
Dr Alice Roberts in the enjoyable BBC TV Series The Incredible Human Journey episode 5 on Australia, notes that evidence of the
Toba eruption is still visible today. At Jwalapuram in southern India
we can find miles upon miles of thick layers of white ash, left over when Mount Toba erupted. Further excavation of the site shows lots of human stone tools which date
78,000 years old, (archaic Homo sapiens tools), suggesting that ancient human settlements in eastern India pre-dates the Toba eruption.
Whether these ancient human settlements survived the Toba eruption, is another matter.
Once ancient humans arrived Bab al-Mandab or Bab al-Mandeb strait, what happened next, is best explained with molecular genetics.
So in the next section, I will first introduce readers to Mitochondria and Mitochondrial DNA; DNA mutations and how they are located; DNA extraction and sequencing; MtDNA Molecular Clocks and Mutation Rates; Single Nucleotide Polymorphism or SNPs; Mitochondrial Eve; Y-Chromosome DNA and the basics of haplogroups; then explain how molecular genetics helps us
understand human evolution and then use molecular genetics to explain what happened to ancient humans once they arrived Bab al-Mandab or Bab al-Mandeb.
If you prefer to jump straight to the part
where I use molecular genetics to explain what happened to ancient humans once they arrived Bab al-Mandab, go to
Human Mitochondrial DNA Markers (Haplogroups). You can always return back to the start of Section E if you want to know more about the basis of molecular genetics, in relation to human origins.
Before I begin, I want to list three major books that helps to summarise all I have discussed in this ebook up to this point. These books fall in the
category of popular science, so will be enjoyed by everyone!
Becoming Human: Our Past, Present and Future , published by Scientific American in 2013. ASIN: B00EWZC9NK (ebook only).
Humans: From the Beginning: From the First Apes to the First Cities, by Christopher Seddon. Published by Glanville Publications in 2014. ISBN-13: ISBN-13: 978-0992762049.
Human Evolution: A Pelican Introduction , by Robin Dunbar Published by Pelican in 2014. ISBN-13: 978-0141975313.
----------------------------------------------------------------------------------------------------------------------------------------------------
USING DNA TO EXPLAIN HUMAN ANCESTRY AND THE ORIGINS OF HUMANS
So far only fossils have provided the
bulk of evidence in relation to the ancestry and origins of modern humans. It's now time to
turn to the very powerful tool of molecular genetics, to explain the ancestry and origins of modern humans in another way.
This section is broken into many parts. Use the table of contents (at the beginning of this ebook)
to view all parts of this section.
The genetic material (DNA) in a cell’s nucleus controls the functions of the cell,
bringing in nutrients from the body and making (via gene expression) hormones, proteins, enzymes and other chemicals.
Outside the nucleus, is the cell’s cytoplasmic matrix or cytoplasm, which contains, among other things,
very tiny bean-shaped organelles known as mitochondria.
Human cells may house anywhere from 3 to 2,500 mitochondria, depending on cell type: brain,
heart, liver, kidney and muscle cells all have much more mitochondria than bone or skin cells. The brain
cells have the highest number of mitochondria found in any cell as makes the most energy demands, while sperm cells have the smallest number of mitochondria.
An organelle is explained
by the fact that while tissue is made up of cells, within tiny cells we find organelles. However mitochondria are an exception,
because they contain their own DNA, Mitochondria can been best visualised as virtually cells within a cell.
Origin of Mitochondria
About 3 billion years ago, several billion years after what most astronomers call The Big Bang (13 billion years ago), when only tiny primitive single cell organisms or prokaryotes existed and were evolving, simple small bacteria known as
gram negative a-proteobacteia had evolved to use oxygen to generate energy. At some point in time (around 1 billion years ago), much larger and more advanced primitive cells called eukaryotic cells (that would soon become part of multi-cellular organisms like humans)
who had been eating gram negative a-proteobacteia, began to instead allow the a-proteobacteia to co-exist inside them, once natural selection saw it was beneficial to both. While the a-proteobacteia generated energy for the eukaryotic cells, they in turn provided a nice space, (i.e the cytoplasm) for the a-proteobacteia to live in.
Over time, the a-proteobacteia evolved into mitochondria.
This is the reason why scientists say mitochondria evolved by endosymbiosis, because mitochondria originated by an
endosymbiotic event when gram negative a-proteobacteia were captured by eukaryotic cells. There is genetic proof of this: first of all bacteria always use
N-formylmethionyl-tRNA to begin protein production, and in human cells only mitochondria also use N-formylmethionyl-tRNA
to begin protein production by joining amino acids together..
This is because outside the mitochondria, for all cells, the initiating amino acid is methionine, but for mitochondria and bacteria, the initiating amino acid is N-formylmethionine!
Next the circular shape of MtDNA (DNA found in mitochondria) in human and animal cells is similar to the circular shape of
DNA found within bacteria, and finally most of all, mitochondria have two membranes!
(the two membranes belong to the original gram negative a-proteobacteia). Today gram negative bacteria have two membranes, while gram positive bacteria have one membrane.
All other organelles in a human cell, other than the nucleus, have only one membrane.
The closest known relative of mitochondria among the bacteria is the Rickettsia bacteria.
Did You Know That?
Speaking of methionine, the major reason why methionine is a major essential amino acid (cannot be manufactured by human cells and
humans need to eat the right proteins that contain it)
is because if a protein diet does not have enough methionine or none of it, then your cells cannot produce any proteins!!
Since the initiating amino acid for protein production in cells is methionine.
Proteins rich in methionine include: nuts, beef, fish, dairy products (e.g milk, eggs, cheese etc), pork, beans and soy.
Source: Lang, B. F., Gray, M. W., and Burger, G. (1999). Mitochondrial Genome Evolution and the Origin of Eukaryotes.
Annual Review of Genetics journal 33, 351-397.
The Functions of Mitochondria
Mitochondria help create energy for the cell, i.e. mitochondria are the energy powerhouses of
cells in a human body. Without mitochondria we cannot generate the energy
needed to do various tasks like walking and running or generate heat to keep us warm at 37 degrees celsius.
Some cells such as the brain cells, liver cells and muscle cells need lots n lots of energy, so these types of cells have lots more
mitochondria compared to other cells like skin cells. Some cells such as red blood cells do not have any mitochondria at all (have a guess why!).
All human cells such as muscle cells,
have a fixed amount of mitochondria, this also means all human cells have a fixed amount of mitochondrial DNA. To maintain a fixed amount of mitochondrial DNA,
a mechanism exists in the enzymes that make copies of mitochondrial DNA on a regular basis in cells. In very rare instances, a baby is sometimes born with
a mutation in which a there is a reduction in the ability to maintain regular copies of mitochondrial DNA in cells such as muscle cells. Over a period of time,
cells in the baby will begin to
have a reduction in the overall amount of mitochondrial DNA, as not enough copies are not being made long term. If not treated, such depletion in the amount of
mitochondrial DNA will lead to a hard to treat disorder called Mitochondrial DNA Depletion.
When this happens in muscle cells, they start to waste away tragically for the baby.
The energy generated by
mitochondria is in the form of a very high-energy chemical
called ATP or Adenosine Triphosphate. Mitochondria make ATP molecules via cycles of a 5-stage biochemical process known as the
Electron Transport Chain or ETC. During final stages of ETC, a biochemical process known as Oxidative Phosphorylation or Oxphos, takes place,
where hydrogen atoms
are seperated into protons (H+) and high-energy electrons. All this takes place in the mitochondria. By the way, hydrogen (element number 1) on the periodic table
is a very special unique element. Normal hydrogen atoms have just one electron (with - charge) and one proton (with + charge). It has no neutrons!
Because of this arrangement hydrogen atom is readily exploited in biochemeical reactions. When a redox reaction (discussed in detail later) involving enzymes
needs an electron to proceed, it
pinches it from nearby hydrogen atoms which always readily gives up its electrons. When this occurs, the hydrogen atom becomes an ion, i.e. H+.
Because hydrogen atoms only have one proton,
a hydrogen ion or H+ is also called a proton! It becomes obvious that one reason why water is so essential for life
(apart from forming so many important biochemicals in living things and making up over 60% of our bones, organs and tissue) is because water is the simpliest and fastest molecule
that can give up its hydrogen atoms (i.e. electrons), for essential redox reactions to occur!
For every cycle of the ETC / Oxidative Phosphorylation, 32 to 36 ATP molecules are produced.
A very efficient way to make energy (i.e. better than each ETC cycle producing just 1 ATP molecule). N.B. By itself ATP does nothing. But when ATP reacts with water
it releases lots of energy (reaction with water causes ATP to split into ADP and a phosphate group, both liberating energy in the process).
When we
eat carbohydrates like rice, potatoes and bread, it is mostly broken down (digested) by enzymes in the mouth and small intestines to smaller molecules called glucose.
This is because only small molecules like glucose or amino acids (from digested protein meal) can leave the small intestines, enter the bloodstream
and make its way to our cells. Not all the carbohydrates we eat are utilised for ATP energy rightaway, some are stored as carbohydrate reserves known as glycogen.
Plants store their carbohydrate reserves as starch. So in reality, when we eat carbohydrates like potatoes and yam, we are of course eating starch. But some
carbohydrates like bread, cakes, and spagetti are man-made.
To kick start the ETC / Oxidative Phosphorylation to generate ATP, mitochondria in cells need a starting molecule. Glucose is way too big to be the starting molecule
for the super tiny mitochondria, but when glucose is broken down further, it is converted into a much smaller molecule mitochondria can handle to generate energy.
This smaller molecule is known as Pyruvate (i.e. pyruvic acid ionic form). Why is pyruvate smaller than glucose?
Well glucose has 6 carbon atoms, while pyruvate has only 3 carbon atoms. We use term
pyruvate not pyruvic acid, because in human cells, many carboxylic acids (weak organic acids in the human cell) exists in ionic form, having lost hydrogen ions. Thus
carboxylic acids such as malic acid exist as malate, ditto for citric acid (citrate) and pyruvic acid (pyruvate) etc.
It is thus the further metabolism, strictly speaking catabolism (or break down) of glucose or glycolysis
that yields pyruvate. The conversion of glucose into pyruvate in human cells is VERY COMPLEX, it involves roughly 10 different intermediate chemicals
and each conversion of a chemical along the way controlled by a very specific enzyme. For instance the first intermediate created during the
initial breakdown of glucose is Glucose-6-Phosphate via an enzyme called Hexokinase (cells in the liver and pancreas use a related enzyme known as Glucokinase).
Glycolysis is also called the Embden-Meyerhof-Parnas Pathway. This rather complicated process actually took science a long time to discover, and more than 8 scientists
take credit for finally discovering how glycolysis works. But three European biochemists filled the final jigsaw puzzle:
Drs Gustav Embden, Otto Meyerhof, and Jakub Karol Parnas, hence the name Embden-Meyerhof-Parnas Pathway.
Glycolysis only occurs outside the mitochondria, i.e. in the cytoplasm (by itself, glycolysis actually produces just 2 ATP molecules).
To recap: One molecule of glucose makes two molecules of pyruvate (or pyruvic acid) and two molecules of ATP.
Thus once formed, Pyruvate now enters the mitochondria where it is oxidised
(via the ETC / Oxidative Phosphorylation) and yields much more ATP molecules, about 32 to 36 ATP (to provide us with heat and energy),
as well as CO2, (carbon dioxide) and water molecules.
There must have been numerous easy ways evolution could have taken, just to generate energy from glucose. But alas evolution chose a much complicated way!
Recall
that glycolysis involves
10 different intermediate chemicals just to make pyruvate!! Well once formed, before pyruvate can enter the ETC / Oxidative Phosphorylation stage,
it must first pass through a process that creates along the way 8 different intermediate chemicals!! This complicated process is called the
Krebs Cycle.
The reason why pyruvate must go through the Krebs Cycle is because, the ETC / Oxidative Phosphorylation only well works with certain biochemicals (known as coenzymes) i.e. NAD or Nicotinamide Adenine
Dinucleotide and FAD or Flavin Adenine Dinucleotide. Both of these biochemicals are way much better in handling and manipulating
electrons in redox reactions (discussed below) than puruvate. Recall that during final stages of the ETC,
a biochemical process known as Oxidative Phosphorylation or Oxphos, takes place,
where hydrogen atoms
are seperated into protons (H+) and high-energy electrons. Only NAD and FAD can do this electron juggling the right way.
Vitamin B2 or Riboflavin in our diet is needed to make FAD, while vitamin B3 or Niacin in our diet is needed to make NAD.
Both FAD and NAD usually work together.
The Krebs Cycle cycle consists of eight steps, each catalyzed by eight different enzymes and the creation of 8 different intermediate biochemicals.
The cycle is initiated when pyruvate is first converted into
Acetyl-CoA (short for Acetyl CoEnzyme A, more of this later on in the eBook).
In this conversion, pyruvate simply combines with CoEnzyme A to form Acetyl CoEnzyme A.
Biochemists call the stage where pyruvate is converted into Acetyl CoEnzyme A,
the
Link Reaction or the Swanson Conversion . It is NOT yet part of the Krebs Cycle, but involves what is known as pyruvate decarboxylation.
Only when Acetyl-CoA reacts with a chemical in cells called oxaloacetate, to form citrate (a ionic form of citric acid)
does the Krebs Cycle officially begin. During this cycle
in a succession of 7 chemical reactions,
citrate goes through a series of oxidations (producing 7 chemical intermediates along the way) to produce malate (ionic form of malic acid).
The Krebs Cycle officially ends at this point. But malate can oxidized back to oxaloacetate.
Thus each complete turn of the Krebs Cycle always results in the regeneration of oxaloacetate! The Krebs Cycle is thus perpetual and as long as a cell needs energy on a regular basis, the Krebs Cycle will be there to help cells get energy.
The huge amounts of useful energy obtained from the oxidation of pyruvate in the Krebs Cycle, is now captured by the coenzymes NAD and FAD.
For each complete each turn of the Krebs Cycle, three
molecules of NAD are reduced to NADH and one molecule of FAD is reduced to FADH2. The amounts of energy transfers occur through the relay of electrons
from one substance to another, a process carried out through the chemical reactions known as oxidation and reduction, or Redox Reactions.
Oxidation involves the loss of electrons from a substance, while reduction involves the addition of electrons.
NADH and FADH2 now transfer the huge energy (on the hydrogen atoms) obtained from the Krebs Cycle
to the ETC, which in turn then uses these energy rich hydrogen atoms to regenerate energy needed to reproduce ATP
through the process of oxidative phosphorylation.
Yes the generation of energy from glucose to pyruvate then onto malate and finally Oxphos is that complicated. This has been the principle way to make energy
for our cells for millions of years. There is no other alternative.
By itself newly formed ATP is like a brand new alkaline battery, and it will only release its huge amounts of stored energy if something else happens:
when ATP reacts with water (or hydrolysed)
it finally releases all the stored energy (the reaction with water causes ATP to split into ADP and a high energy phosphate group, liberating energy and heat in the process).
The ADP can then be reused to make ATP, but only via a brand new fresh round of the Krebs Cycle and ETC / Oxidative Phosphorylation!
Biochemists calculated that the daily intake of 2,500 food calories translates into a turnover of a whopping 180 kg or 400 pounds of ATP.
At the end of the day, we can conclude that the metabolism of glucose into smaller components known as Pyruvate (glycolysis) in cytoplasm and its further
oxidation via the Link Reaction, Krebs Cycle and ETC / Oxidative Phosphorylation in the mitochondria
yields in total 32 to 36 ATP molecules per cycle.
It takes the human body less than a tenth of a second to make hundreds of thousands of ATP molecules, so
ETC / Oxidative Phosphorylation is a very fast process.
In comparison,
metabolism of fat and oils like butter into smaller components known as Glycerol and fatty acids yields 28 ATP molecules per ETC cycle. Clearly
carbohydrates such as bread and potatoes yield slightly more energy than fats. When proteins are metabolised into amino acids then further oxidised
(via the metabolic pathway known as the Cahill Cycle), they yield far smaller ATP molecules (less than 18 ATP molecules per ETC cycle):
Proteins are not good energy sources and better off used as building materials. Remarkably it is a good idea that proteins and fats/oil CAN produce ATP, this is
because like carbohydrates,
both proteins and fats/oil can both reproduce glucose and Acetyl-CoA when they are metabolised in a special way.
Actually it is important that proteins can produce ATP: the
reason why a person appears so thin during starvation, is not only because they are not eating at all,
but because the human muscles (full of protein) are being broken down to help the body make glucose for ATP production.
This normally occurs long after the body of a starving person converted most of its stored carbohydrates or glycogen to ATP via glucose.
The human body is virtually eating itself to stay alive!
The human brain has very high energy demands as previously discussed, so when a person is starving and not eating, after a few days using up
fat and glycogen reserves,
the human brain has to make ends meet:
it intiates the Cahill Cycle,
using the protein in the muscles and elsewhere in the human body to make ATP. This is because the major source of glucose during starvation
is gluconeogenesis or the reproduction of glucose
from amino acids (i.e. produced during the breakdown of proteins). However the brain will normally only initate the Cahill Cycle once carbohydrate
reserves (or glycogen) and
fat reserves in the body are depleted or not in sufficient amounts to make ATP long term. When there is no more viable protein left to change to ATP,
the human body can't live any more longer and just shuts down.
The diagram above shows the pathway for metabolism of glucose into smaller components known as
Pyruvate in cell cytoplasm and its further
oxidation via the Krebs Cycle and ETC / Oxidative Phosphorylation in the cell's mitochondria to produce ATP. The Krebs Cycle is also called the
Citric Acid Cycle because the first major intermediate chemical formed when pyruvate is converted to Acetyl-CoA before entering the Krebs Cycle is
citrate (i.e. citric acid ionic form).
Diagram above shows how Electron Transport Chain / Oxidative Phosphorylation inside Mitochondria,
that produces 32 to 36 ATP molecules per cycle (viz Complex I to IV, then the final stage or ATP synthase stage) that yields ATP molecules.
At the beginning of the electron transport chain, the energy-rich hydrogen atoms on NADH and FADH2 are removed, producing the oxidized coenzyme, NAD+, FAD and
a proton (H+) and two electrons (e-). The electrons are transferred along a chain of 4
different electron carrier protein molecules (Complex I to IV), this electron transfer process is known of course as the electron transport chain or ETC.
It is during the final stages of the ETC, that Oxidative Phosphorylation or Oxphos, takes place: hydrogen atoms
are seperated into protons (H+) and high-energy electrons used by ATP Synthase enzyme convert pre-existing ADP (from the previous breakdown of ATP) to new ATP molecules . Water molecules are produced because during Oxphos, unused protons and electrons recombine to form hydrogen,
which itself recombines with oxygen to form water. This is the reason why oxygen is called the final electron (hydrogen) acceptor in Oxphos!
Let's now summarize the ATP production process
A) Glycolysis, the Link Reaction, and the Krebs Cycle all produce 10 NADH and 2 FADH2, also resulting in 4 ATP:
2 from glycolysis and 2 from Krebs Cycle, the Link Reaction does not make any ATP. The Krebs Cycle also produces CO2 which we have to breath out, as too much CO2 in our
system can cause issues such hypercapnia OR cause too much carbonic acid (CO2 combining with water) making blood have lower pH or acidemia.
B) The 10 NADH and 2 FADH2 are oxidised into NAD+ and FAD in the ETC (to be reused), and in the process 32 ATP are produced, resulting in a grand total of 36 ATP
Sometimes its 32 ATP or less (28 to 30 is possible), because some ATP escape along the way as heat. Water molecules are also produced when ETC finally makes ATP.
The Krebs Cycle alongside Electron Transport Chain / Oxidative Phosphorylation is so important
in the generation of energy that
human cells could not function without these three metabolic processes. For discovering the
secrets of the Krebs Cycle and the Glyoxylate Cycle, Drs Hans Adolf Krebs and Fritz Albert Lipmann were awarded the Nobel Prize in 1953.
The way in which the Electron Transport Chain / Oxidative Phosphorylation makes ATP molecules via ion-transporting enzymes and other enzymes
was finally worked out in much detail by biochemists
Drs Paul D. Boyer, Jens S. Skou and John Walker, who all received the Nobel Prize in Chemistry in 1997
for this discovery.
Meanwhile earlier in the early 20th century, German biochemist Professor Hans von Euler-Chelpin worked out the biochemical structure of NAD and in 1929 both
Von Euler-Chelpin and British biochemist Dr Arthur Harden shared the 1929 Chemistry Nobel Prize for the discovery of NAD and other coenzymes.
In 1922, German biochemist Dr Otto Fritz Meyerhof and British physiologist Dr Archibald Vivian Hill were awarded the Nobel Prize in
Medicine for discovering in detail how glycolysis works.
Cells such as
bacteria, which do not have mitochondria or like to live in oxygen-free environments (i.e. anaerobic bacteria) use
anaerobic glycolysis to make ATP. 99% of all
animals and insects etc use Krebs Cycle and ETC / Oxidative Phosphorylation to make ATP like humans do. Only viruses do not
need to make ATP, because they steal the ATP in cells they invade. Plants (which have chloroplasts instead of mitochondria and use photosynthesis)
and fungi etc can also use a variation
of the Krebs Cycle (or the Glyoxylate Cycle) to make ATP molecules. The key molecule for making ATP is glucose in all living things (plants and animas).
Since plants cannot "eat" carbohydrates to obtain glucose as humans and animals do, they have to find a way to make glucose. Plants achieve this by
using what is called the Calvin Cycle and photosynthesis.
This brings up an important fact about the relationship between plants and animals in making ATP.
Animals and humans need oxygen to help break down glucose to yield ATP (using the Krebs Cycle and ETC / Oxidative Phosphorylation).
Plants need carbon dioxide to make glucose (which they also use as energy source for ATP production) via photosynthesis and the Calvin Cycle. Nature worked out a solution: animals and humans
produce carbon dioxide when making ATP, and
plants produce oxygen while making ATP. The end result is that a near balance in the amount of both carbon dioxide and oxygen
in the air makes life possible on Earth!
Drs Melvin Ellis Calvin with Andrew Benson and James Bassham, jointly won the 1961 Nobel Prize in Chemistry for discovering the Calvin Cycle.
The gas hydrogen cyanide works by instantly disrupting (inhibiting) the enzymes (Cytochrome C Oxidase family of enzymes) that run
the last stages of the ETC / Oxidative Phosphorylation, via starving cells of oxygen. Since the Electron Transport Chain / Oxidative Phosphorylation
will not work without oxygen, and if the ETC / Oxidative Phosphorylation isn't working, then our cells, tissue, organs etc won't get any ATP and start to shut down.
It is the oxygen we breath in that makes the ETC / Oxidative Phosphorylation work.
In the final analysis, Mitochondria play an important role in sustaining life.
Read more about Krebs Cycle, ETC / Oxidative Phosphorylation in the easy-to-read book for beginners: Biochemistry for Dummies, primarily chapters 12 and 13.
Some cells such as Red Blood Cells do not have any mitochondria. So how on earth do they make ATP molecules?
Red Blood Cells use a process known as Anaerobic Glycolysis to make ATP: recall that I explained that
by itself, glycolysis which occurs outside the mitochondria, produces just 2 ATP molecules, thats just enough to sustain red blood cells!! but
would not be emough to sustain brain cells.
Glycolysis can occur with or without oxygen (i.e aerobic glycolysis or anaerobic
glycolysis). Both yield roughly 2 ATP molecules,
however anaerobic glycolysis is much faster than aerobic glycolysis, and later on I will discuss how humans are forced to use
anaerobic glycolysis, when ATP produced by aerobic glycolysis and ETC /Oxphos is just not enough.
The Krebs Cycle does not just help to produce important ATP molecules, it also provides several other important starting molecules or precursors, some are used to create
several amino acids, (part of the non-essential amino acids that can be made by human cells). The Krebs Cycle also reproduces
NADH (or reduced NAD or
reduced Nicotinamide Adenine Dinucelotide) continuously.
We had earlier discussed that
NAD itself is an important coenzyme form of vitamin B3 or niacin, acting as an electron carrier, delivering electrons (e.g. from hydrogen atoms) in
several metabolic reactions involving oxidation and reduction, as seen in the ETC diagram above.
What is a Coenzyme?
Some enzymes, e.g. pepsin in our guts, catalyse biochemical reactions by themselves,
but many other enzymes do require helper substances such as coenzymes (such as NAD and FAD) or metal ions.
A continuous supply of vitamin B3 or Niacin and vitamin B2 or Riboflavin in our
food is needed to make the coenzymes NAD and FAD on a regular basis (because our cells by themselves cannot make these vitamins). Hence vitamins B3 and B2 are good examples of vitamins that helps us make energy.
As NADH changes to NAD and vice versa, it transports electrons (i.e from hydrogen atoms) in oxidation and reduction biochemical reactions known as
redox reactions, which we talked about earlier on.
Thousands of important redox reactions occur in cells in all parts of the human body every minute. The ETC is one good example of NAD's involvement in redox.
For example:
Each time reduction occurs NAD changes to NADH.
Each time oxidation occurs NADH changes to NAD.
Lets say that an enzyme needs to oxidise a molecule called XYZ, then a reduction of NAD to NADH needs to occur to enable oxidation of XYZ.
For a good example of this see the sub-heading "Alcohol and ATP" below. Redox activities in cells need near similar levels of NAD and NADH, and thus perpetual end results of oxidation and reduction biochemical reactions in cells are continuous to
maintain the supply of near equal amounts of NAD and NADH.
Because of the positive charge on the nitrogen atom in the nicotinamide ring of NAD,
the oxidised form of this important redox reagent is often depicted as NAD+.
Therefore NAD+ is the oxidised form of the NAD coenzyme, while NADH is of course
reduced NAD!
A molecule's acquisition of electrons is thus called reduction, this is why NADH is the reduced form of NAD+
In cells, most oxidations are accomplished by the removal of hydrogen atoms (i.e electrons).
Meanwhile most reductions are accomplished by the addition of hydrogen atoms (i.e. electrons) .
NAD coenzyme plays a crucial role in this. Each molecule of NAD+ can acquire two electrons; that is, be reduced by two electrons.
However, only one proton (i.e H+) accompanies the reduction.
NADP+ or Nicotinamide Adenine Dinucleotide Phosphate is a cousin of NAD+ and is a coenzyme needed for metabolic
reactions, such as synthesis of lipids and nucleic acids in cells. Cells make NADP+ via another biochemical cycle (different from the Krebs Cycle) known as the
Pentose Phosphate Pathway. NADPH is the reduced form of NADP+ just as NADH is the reduced form of NAD+
NAD+ + 2H -> NADH + H+
This is Reduction The opposite of this reaction is Oxidation!
Alcohol and ATP
A good example of how reduction works in a biochemical reactions in humans is seen in alcohol consumption.
Alcohol, even in moderate amounts in humans, is seen as toxic by the liver! and so it initiates a wonderful series of biochemical actions to convert most of the
alcohol we drink to acetaldehyde and then into acetic acid and ultimately Acetyl-CoA. Have a guess
why Acetyl-CoA is also known as "activated acetate". By the way....acetic acid is a type harmless carboxylic acid, which are types of
weak organic acids widespread in nature and found in both plant and animals.
For example, acetic acid (IUPAC name or official chemical name: Ethanoic acid) is also present in vinegar, wine, cider and is part of many biochemicals in our body such as acetylcholine neurotransmitter; malic acid (IUPAC name: Hydroxybutanedioic acid) is found in plums, apples and grapes;
lactic acid (2-Hydroxypropanoic acid) is present in sour milk; citric acid is contained in citrus fruits such as lemons, lime, oranges, and grapefruits; tannic acid is found in the bark of a number of trees,
and tartaric acid (2,3-Dihydroxybutanedioic acid) is found in many plants and grapes.
Meanwhile insects like ants sting with formic acid (IUPAC Methanoic acid). Amino acids are molecules which contain both a carboxylic acid and an amine group, for example amino acid glycine is 2-aminoethanoic acid. Esters found in all living things, the products of acids and alcohols, also contain carboxylic acids.
These include fats and oils or lipids (products of fatty acids and a type of alcohol called glycerol); flavours of fruits and odours of flowers.
When I mentioned that the liver works to convert most of the alcohol we drink to
to acetic acid (acetate) and then to Acetyl-CoA, it must have rang a bell. Indeed...recall earlier on I mentioned that Acetyl-CoA is produced when we eat carbohydrates like potatoes, which then gets broken
down to glucose and then pyruvate (i.e. aerobic glycolysis), then further converted to Acetyl-CoA.
Once produced, Acetyl-CoA enters the Krebs Cycle / ETC were it produces useful stuff like ATP. So in a beautiful way, our liver converts most of the alcohol we drink (which serves no
useful purpose in humans other than getting us high and drunk) into useful ATP. How on earth does the liver convert toxic alcohol to useful Acetyl-CoA?
The answer is NAD+/NADH.
To detoxify alcohol, the liver must rely on a group of important enzymes biochemists call Alcohol Dehydrogenase or ADH.
The alcohol or ethanol is converted or broken down or oxidised by Alcohol Dehydrogenase to acetaldehyde (ethanal) by the reduction of NAD+ to NADH.
Acetaldehyde is then converted to acetic acid (acetate) by Aldehyde Dehydrogenase or ALDH before final conversion to Acetyl-CoA (acetic acid reacts with
Coenzyme A to form Acetyl-CoA). The specific alcohol dehydrogenase enzyme
involved is known as Alcohol Dehydrogenase 4 or ADH4. Because acetic acid easily dissociates into acetate and hydrogen ions (H+), broadly speaking we can use either
acetate to refer to acetic acid or acetic acid radical. When one adds water to acetic acid, it reacts with the water and dissociates in a reversible fashion to form hydronium and acetate ions.
Acetate will react with water to give you back acetic acid!
In this biochemical reaction, two electrons (the two electrons of the C-H bond) are REMOVED from the alcohol (ethanol) molecule.
One hydrogen atom and both electrons, are transferred to NAD+, generating NADH.
So the end result of the reduction of NAD+ to NADH is the oxidation of alcohol to acetaldehyde! "alcohol dehydrogenase" is Greek for an enzyme which removes hydrogen atoms from the alcohol molecule, (which are transferred to NAD+, generating NADH).
Apart from Alcohol Dehydrogenase, two other enzymes help the liver use Alcohol Dehydrogenase to breakdown alcohol: cytochrome P450 (CYP2E1)
and catalase. In the next part of the conversion, acetaldehyde is oxidised to acetate (acetic acid) before final conversion to Acetyl-CoA, (acetic acid reacts with
Coenzyme A in the liver to form Acetyl-CoA).
Acetaldehyde dehydrogenase in the mitochondria of liver cells
removes a hydrogen atom from acetaldehyde to produce an acetic acid radical, this
hydrogen atom combines with NAD+ to form NADH. A similar situation we discovered earlier on with Alcohol Dehydrogenase.
There are several varieties of aldehyde dehydrogenase found in the human body. The one which normally breaks down acetaldehyde is called ALDH2.
There is another variety aldehyde dehydrogenase found in the human body which is called ALDH2*2. ALDH2*2 is only about 8% as efficient as ALDH2 in
metabolizing acetaldehyde. Some East Asian people have ALDH2*2 instead of ALDH2 in their bodies. These individuals find the effect of alcohol to be very unpleasant.
Our Wonderful Defence Against Too Much Alcohol
As mentioned earlier on, not all the alcohol we drink is converted in the liver, otherwise we will not feel the effects of drinking alcohol! Roughly about
2% to 8% travels through liver unconverted to our bloodstream and is eventually lost through urine, sweat, or the breath. The other 92% to 98% is metabolised
or converted to Acetyl-CoA
by the liver.
By the way acetaldehyde is very poisonous to all human cells, and only our liver cells can survive acetaldehyde molecules and
convert it to harmless acetic acid. During my biochemistry lectures at university, I was amazed how very specific cells in the human body can manipulate molecules, or
breakdown molecules or
make new molecules. For instance only red blood cells can bind to oxygen molecules tightly and carry fresh new oxygen molecules from the lungs to other parts of the body. In another example, only
thyroid cells in the thyroid gland can combine both the element iodine (from food we eat), and the aminoacid tyrosine (using specialised enzymes) to make thyroid hormone.
If a person drinks way too much alcohol, it will simply overwhelm the liver, meaning lots of
unconverted alcohol (over 20%) will start to leak into the bloodstream, leading to very serious medical issues like alcohol poisoning or liver damage.
I mentioned two other enzymes that help our liver's Alcohol Dehydrogenase breakdown alcohol; Cytochrome P450 2E1 and Catalase.
I also mentioned that if a person drinks way too much alcohol, it will simply overwhelm the liver, this is where Cytochrome P450 2E1 in particularly comes in.
Cytochrome P450 2E1 (abbreviated CYP2E1) and also found in the liver becomes involved in metabolising alcohol in
chronic heavy drinkers or people who drink too much alcohol, using an alternative biochemical process known as Microsomal Ethanol Oxidising System or MEOS, it uses the cousin of NAD+, we mentioned earlier on: NADP+.
In light alcohol drinkers nearly all the alcohol consumed i.e. 92% to 98%,
is taken care of by alcohol dehydrogenase as described above, so MEOS does not get involved.
Meanwhile Catalase is found in tiny organs inside of cells called peroxisomes. Catalase which is found all over the human body helps alcohol dehydrogenase as it turns
alcohol into acetaldehyde: recall that I mentioned that
two hydrogen atoms and two electrons are REMOVED from the alcohol (ethanol) molecule.
One hydrogen atom and both electrons, are transferred to NAD+, generating NADH. What happened to the other hydrogen atom??? This is where Catalase comes in.
The other hydrogen which is released is bound to hydrogen peroxide molecules which then becomes water! Although catalase is
active everywhere in the body, catalase is of particular interest to medical researchers because it metabolises alcohol that escaped being
converted by the liver and ended up
in the brain. The acetaldehyde
released into the brain by the metabolism of alcohol by catalase has the potential to combine with neurotransmitters to form new biochemicas known
as THIQs (tetrahydroisoquinolines, also sometimes called TIQs). Some researchers believe that THIQs are the cause of alcohol addiction and that the
presence of THIQs in the brain or bloodstream distinguishes addicted drinkers from casual or social drinkers.
Other researchers strongly dispute the validity of the THIQ hypothesis of
alcohol addiction. THIQ was discovered in brains of alcoholics in Houston, Texas in the 1970s by a biochemist named Dr Virginia Davis during an extensive alcoholics research project.
She had discovered that in the brains of chronic alcoholics, a substance that is closely related to Heroin was present. This substance identified as Tetrahydrolsoqulnoline or THIQ.
Normally when a person shoots heroin into their body to get high, some of the heroin breaks down and turns into THIQ.
The alcoholics research project of Dr Virginia Davis showed that none patients had not been using heroin! so how on earth did the THIQ get there? Dr Virginia Davis through
some clever biochemistry detective work then figured
out where the THIQ came from, using
the neurotransmitters and acetaldehyde angle.
From above biochemical
reactions above, it is clear that
both the enzymes Alcohol Dehydrogenase and Aldehyde Dehydrogenase would not be able to help the liver convert alcohol to harmless acetic acid without the help of
the coenzyme NAD+ There are more than 100 important biochemical reactions in human cells
such as the Pentose Phosphate Pathway or the Krebs Cycle and ETC / Oxidative Phosphorylation,
that require the presence of the all-important coenzymes FAD, NAD+ and/or NADP+
One more important metabolic activity that requires daily doses of coenzymes NAD+ and/or NADP+ is The Cori Cycle discovered by biochemists
Drs Carl Ferdinand Cori and Gerty Cori, earning them the 1947 Nobel Prize in Medicine.
The Cori Cycle refers to the metabolic pathway in which lactate (i.e. lactic acid ionic form) produced by anaerobic glycolysis in the muscles
moves via the bloodstream to the liver where it is converted to blood glucose (for conversion into ATP as described above) and glycogen (stored glucose reserve).
When athletes do long exhaustive exercise in gyms, or do 800m or 10,000m track and field races, or run marathons, they feel intense pain in the muscles (fatigue) afterwards. This is due to
lactic acid accumulation.
When energy is required to perform exercise, it is supplied from the breakdown of ATP. Initially the air (oxygen) we breath in as well as eating carbohydrates
helps produce the required
ATP via aerobic glycolysis AND the Krebs Cycle/ETC, the end result being digested carbohydrates like rice is converted to blood glucose then altimately ATP.
However as the race progresses our stock ATP starts to run low, remember athletes are not eating and racing at the same time!! Hence athletes
must find ways of replenishing spent ATP as soon as possible, or they would collapse with extreme exhaustion.
This is where anaerobic glycolysis comes in. The process in cells of re-synthesing ATP without the involvement of oxygen is called anaerobic glycolysis.
So once ATP from normal aerobic glycolysis is used up or runs very low, anaerobic glycolysis is called in to help make more ATP for the athletes.
However there is a flipside:
as anaerobic glycolysis begins to
kick in lots of lactic acid starts to build up in our muscle cells, since anaerobic glycolysis always produces lactic acid. Next the Cori Cycle
starts to convert the produced lactic acid directly to blood glucose where gets metabolised and
it enters the Krebs Cycle and ETC / Oxidative Phosphorylation and so ultimately produces more ATP!!!
But as the long distance running or long exhaustive exercise continues, anaerobic glycolysis goes into full capacity mode leading to
lots of lactic acid accumulating in muscle cells and the Cori Cycle cannot metabolise all the excess lactic acid being produced in the muscles,
which itself soon
leads to intense pain in muscles or muscle fatigue! Once we finish the race and rest a bit,
the Cori Cycle empties the muscles of any remaining excess lactic acid accumulated, and anaerobic glycolysis is slowly switched off,
as the huge demand for ATP is now reduced and aerobic glycolysis and the Krebs Cycle/ETC take over as sole suppliers of ATP!
Some experienced professional athletes over
time can train their bodies to use aerobic glycolysis much longer and only use anaerobic
glycolysis after the middle distance of the race. This means they train their bodies to produce less lactic acid (less lactic acid build-up).
Ever wondered why athletes in long distance races, prefer start the race at a much slower pace compared to the faster 100m sprint?
This is done to ensure they use only aerobic glycolysis for as long as possible.
But evolution conveys this amazing ability naturally to some athletes! This is why Kenyan, Eritrean and Ethiopian long distance athletes usually win more long distance races and have produced the most marathon champions.
Evolution has equipped them to use aerobic glycolysis much longer than other athletes and thus less lactic acid buildup. Thus as athletes near the last 400m of a 10,000m race,
while other athletes have been using anaerobic glycolysis much earlier and are beginning to slow down due to muscle fatigue caused by lactic acid build-up,
Kenyan and Ethiopian athletes are still on aerobic glycolysis a few minutes or so before they have to start using anaerobic glycolysis like everyone else, but by then
they are near the end of the race.
RECAP
While some cells such as certain types of bacteria, red blood cells and human and animal muscle cells can get energy from
breaking down glucose to lactate (i.e. lactic acid) via ANAEROBIC GYCOLYSIS;
90% of the time, most animal and human cells get energy from breaking down glucose to CO2 (carbon dioxide) and water via
AEROBIC GYCOLYSIS & Krebs Cyce (leading to ETC/Oxidative
Phosphorylation). There is in fact a
3rd way to break down glucose!!! Certain plant cells known as yeast and some types of bacteria CAN break down glucose but not via glycolysis but via a metabolic process known as
FERMENTATION. The end-product of
this type of catabolism of glucose is alcohol and CO2. Put two tables spoons of common sugar (or sucrose, which is a bigger brother of glucose) into a glass of clean water,
mix it, and a few days later watch it being converted to
alcohol (smell is obvious) and CO2 (the bubbles you see) by yeast in the air!
Mankind has exploited this time of carbohydrate breakdown to produce all sorts of delicious alcoholic drinks for thousands of years.
As seen above, each Mitochondrion in a cell also contains their own DNA, which they use to make proteins such as enzymes;
the DNA in the nucleus oversees production of the rest of the proteins (including hormones) necessary for life and its functions. The space in a cell in-between all its different organelles
such as Golgi Apparatus, Ribosomes, Mitochondria, Smooth ER etc is called the cell's Cytoplasm.
N.B. Remember it is actually genes in the cell's nucleus DNA that determine ethnic group, and not the genes in the mitochondria DNA (MtDNA).
While MtDNA mutations tell us when and where exactly different ethnic groups emerged around the world at different points in time via migration out of Africa,
for each point where a different MtDNA marker arose (due to mutation in MtDNA), we can say with certainty that a corresponding mutation in nuclear DNA
had occurred just before or after the mutation in MtDNA,
leading to a specific genetic trait.
For instance the genes that control skin colour, via regulating the production of melanin, are only found in the nucleus.
MtDNA tells us that about 70,000 years ago once ancient humans left Africa and entered Yemen, a mutation occurred leading to a different MtDNA marker.
Thus likewise 70,000 years ago a mutation occurred in the nuclear DNA (at chromosomes 15, 16 and 19) that led to a specific genetic trait:
different skin colour pigmentation. In all human cells, chromosome 15, 16 and 19 in the nucleus determines skin, hair and eye colour of an individual.
With this in mind, you may wonder: Did some sort of commuication occur between MtDNA and nuclear DNA? Which mutation was triggered first, MtDNA or Nuclear DNA?
Scientists do note that although the genes in MtDNA and nuclear DNA are very different in function MtDNA DOES exchange signals with nuclear DNA.
How and why these exchange of signals occur is
beyond the scope of this eBook.
Curious about mitochondria? Read more in biochemistry texts such as
Lubert Stryer's popular Biochemistry (ISBN-13: 978-0716746843).
Why are Mitochondria Used in Human Ancestry Research and Population Genetics Projects?
First of all, for reasons not yet fully understood, mitochondrial DNA survives the ravages of time better than nuclear DNA:
when scientists come across fossils, and want to analyse them for genetic research, they first try to obtain mitochondrial DNA which is much easier to isolate than nuclear DNA.
But that is not all, compared to Nuclear DNA (that is the DNA residing in the nucleus), Mitochondrial DNA (or MtDNA)
was thought to be special for DNA ancestry tests for 4 reasons.
Firstly MtDNA have much higher mutation rates than nuclear DNA. High mutation rates are
extremely beneficial for human ancestry research and population genetics projects. The only reason why nuclear DNA does not have high mutation
rates is because human cells have a sophisticated repair mechanism, where nuclear DNA is instantly repaired whenever
cells realise mistakes (mutations) were made in DNA replication, during cell divisions known as mitosis and meiosis (cell division that makes only sperm or egg cells). Unfortunately cells
do not bother to check DNA replication mistakes in MtDNA in the same thorough way as in nuclear DNA, so high mutation rates are the norm.
Specifically high mutation rate occurs in mitochondria because MtDNA lacks protective histones (found in nuclear DNA) and has inefficient DNA repair systems.
Nuclear DNA is wrapped very tightly
around specialised proteins called histones which protect and stabilise nuclear DNA from mutation damage when not in use.
Secondly, while MtDNA mutations occur in an orderly (predictable) fashion, nuclear DNA mutations mostly occur randomly: one cannot study DNA for population genetics purposes if DNA mutations are random!
Thirdly MtDNA is short and relatively simple in comparison to the DNA found
within the nucleus (i.e. nuclear DNA),
Whereas MtDNA has only 37 genes, according to the 2003 $2.7 billion Human Genome Project there are about 70,000 odd genes located in nuclear DNA.
This makes MtDNA relatively easy to analyse and sequence in a shorter time than nuclear DNA. To understand this, lets have a brief look at what makes up a gene: the base pairs of
DNA molecules.
What is DNA?
DNA is the biological molecule that governs heredity. DNA was isolated in 1869 by
German-Swiss biochemist Friedrich Miescher, a professor of physiology at the Swiss University of Basel, but he had no idea that is was an important molecule governing
heredity.
This is because prior to 1940s, most scientists believed that the molecule governing heredity was a protein,
in other words they wrongly believed that genes were proteins. Science is all about
testable theories and hypothesis or predictions. For over 2000 years, starting with Greek philosophers, it was said that a substance or something in cows (testable theory) made it
produce young that looked just like cows and not horses i.e. a heredity substance existed, and no one doubted it: Cows make cows and horses make horses, end of story. When the functions of
proteins were discovered for the first time in the early and late 19th century
by the chemists Antoine François, comte de Fourcroy; Gerardus Johannes Mulder and Jöns Jacob Berzelius and shown to carry out important functions in humans,
the consensus (prediction) was that
the heredity substance was a protein. So when Friedrich Miescher finally "discovers DNA molecules" in the late 19th century, he figures it's some sort of protein (hypothesis).
After several experiments Miescher theorises DNA is not a significant molecule and the theory that heredity substance was a protein continues to be taken as fact, despite DNA being discovered.
In 1909 Danish botanist Wilhelm Johansen coins the word genes for the first time, and believes they play an important part in heredity and so, the new hypothesis (later made a theory) is that
genes are the proteins governing heredity!!
Miescher's DNA discovery is now thus forgotten, at least for now. By the 1920s scientists already knew that genes were located in chromosomes:
dense tangles of nucleic acids and proteins in the nucleus of cells. But of the two major components of chromosomes,
protein and DNA, most leading researchers favoured protein. Even
Professor Linus Pauling, the world's leading structural chemist in 1930s, believed that genes were made of proteins.
Pauling was the first scientist in history to outline basic protein structures at a very detailed molecular level.
It was not until the 1940s and 1950s that Miescher's DNA was suddenly "rediscovered" as the molecule governing heredity, this only made possible by
the many molecular physicists who laid the foundations for the new branch of biology: molecular biology, the study of biology at a molecular level.
Scientists already knew, through
the discoveries of Drs George Beadle and Edward Tatum, in 1941 that
genes make enzymes, hormones and other biological substances, which in turn control
all metabolic processes in cells (they jointly received the 1958 Nobel Prize for Medicine for this important discovery).
But they had no idea that genes were not proteins and very little understanding of genes at molecular level.
It was American microbiologists Drs Oswald T Avery, Colin MacLeod and Maclyn McCarty who in 1943 discovered
that Miescher's DNA and not a protein could be the heredity molecule.
In other words genes are made of DNA molecules not proteins, but again both being microbiologists,
had very little understanding of DNA at molecular level and their postulation was seen as hypothesis and not a serious theory.
With great advances in molecular physics being made in the 1940s,
one of the molecular physicists, Austrian Nobel laureate Dr Erwin Schrödinger wrote an intriguing book in 1944 titled What is Life?.
The purpose of Schrödinger's intriguing book was to a large extent to find out if the vast
new understanding of the stability of atoms and the properties of matter, (i.e. from the School of Quantum Physics developed by Dr Max Planck), could be of help in explaining the nature of genes at a molecular level.
In 1951, both Sir William Lawrence Bragg and Linus Pauling wanted to find the structure of the master molecule of life, the gene.
But both were focused on proteins, again Miescher's DNA given the cold shoulder.
One of the many molecular physicists who read Schrödinger's book and was inspired to learn more about genes at a molecular level was
German-American molecular physicist
Dr Max Delbrück. By studying bacteria and their viruses (known as bacteriophages) at his lab at the Cold Spring Harbour Laboratory on Long Island, New York,
Delbrück and his team were able to establish brand new theories in bacterial genetics, and because this crucially also involved
not just studying protein at a molecular level BUT also DNA at a molecular level as well, Delbrück was able to cast a
shadow of doubt on the long held theory that the molecule governing heredity was a protein. It dawned onto Delbrück that DNA had played a very important
role in his experiments.
Given that Delbrück was now a prominent professor, whatever he discovered carried a lot of weight, two prominent biologists who were privy to Delbrück's work
decided to take another close look at Miescher's DNA.
In 1952, to a packed world press conference, and to the amazement of scientists worldwide who all previously advocated that
protein was the king of heredity, American biologists Drs Alfred D. Hershey and Martha Chase, on the basis of the pioneering work of
Delbrück and others, and aided in part by using bacteria and bacteriophages and radioactivity, independently confirmed the decade old 1943 discovery, (i.e. the work of Oswald T Avery, Colin MacLeod and Maclyn McCarty)
that Miescher's DNA alone was the molecule governing heredity and not protein.
With Delbrück, alongside Alfred D. Hershey and Martha Chase (and other scientists
who replicated Hershey and Chase experiments several times), having established once and
for all that DNA was the hereditary molecule, very
soon scientists now turned their attention to discovering more about Miescher's
DNA at a molecular level, in order to understand much more about genes at a molecular level.
This lead to the important discovery, a year later, of the amazing double helix molecular structure of DNA in 1953. Looking back today we see the sudden interest in DNA
becoming a
very big turnaround, as prior to the 1940s,
very few researchers anywhere in the world, cared much about Miescher's 1869 discovery of DNA.
Because Nobel Prizes were not around in Miescher's time, he missed out on a Nobel Prize.
Delbrück however shared the Nobel Prize for Physiology and Medicine with microbiologists Salvador Luria and Alfred D. Hershey
in 1969 for their important discoveries on bacterial genetics and DNA using bacteria and bacteriophages.
One question comes to mind......... in 1943, Drs Oswald T Avery, Colin MacLeod and Maclyn McCarty HAD postulated that
Miescher's DNA and not a protein must be the heredity molecule. This was way before Delbrück had read Schrödinger's What is Life? and began his pioneering
bacteriophage experiments. So why wasn't this 1943 finding taken seriously by the scientific community? Here's a probable answer.
Rockefeller Institute researcher Oswald T Avery and his team's publication in 1944 about their 1943 discovery, was a little-appreciated paper in 1944 after its
publication.
For years no one paid much attention to Avery's work. Professor Linus Pauling sums it all up:
"I knew the contention that DNA was the hereditary material, but I didn't accept it," Pauling said about his thinking in 1951, a year before Alfred D. Hershey and Martha Chase announcement about DNA.
"I was so pleased with proteins, you know, that I thought that proteins probably are the hereditary material rather than
DNA-but that of course DNA played a part. In whatever I wrote about nucleic acids, I mentioned nucleoproteins,
and I was thinking more of the protein than of the nucleic acids....."
POSTSCRIPT
Today our accumulated knowledge of DNA is very much advanced compared to the 1950s and 1960s, its come to a point that in January 2016, a British geneticist was
given the OK to edit the DNA in human embryos, to figure out more about genes in the development of an embryo to a baby. Is this molecular biology gone to far?
In fact back in the 1970s, when our understanding of DNA was kinda "getting out of control" scientists did decide to debate the merits of playing God with DNA.
Two meetings in 1973 and 1975, saw the superstars of DNA back then,
(A-list of top geneticists, biochemists and molecular biologists around the world such as Paul Berg, James Watson, Maxine Singer, Sydney Brenner etc), gather together in the U.S. for debates about advanced DNA research, such as genetic engineering
and gene cloning. What triggered this call for debates was the astounding experiment that occurred in early 1973: biochemists
Herbert Boyer and Stanley Cohen at Stanford University, had just reproduced Recombinant DNA by splicing the DNA of two different species (mouse and bacteria DNA) together!
initially it was seen as a wonderful scientific achievement, but some scientists began to worry that some sort of unknown Frankenstein
DNA could be created in a lab and escape to wreck havoc on humanity.
The first meeting organised to debate about advanced DNA research was the June 1973 Gordon Research Conference in New Hampshire, USA. It was a smaller
meeting of less than 100 scientists.
The second meeting in California, USA in February 1975 (with over 200 scientists in attendance) was the most important, it was called the Asilomar Conference. Among other things, after the meeting
finished, was the consensus that there was a need for the adoption of guidelines regulating DNA research, so that it was done safely in a laboratory.
This meeting lead to governments around the world issuing guidelines on what types of DNA research were okay and not okay.
This meant genetic engineering research could continue but under stringent guidelines.
The Asilomar Conference marked the beginning of an exceptional era for science and for the public discussion of science policy.
Today advanced DNA research is
one of the most tightly regulated in the world, however the benefits of genetic engineering,
and the risks and ethical dilemmas that it presents, are part of everyday public discourse,
thrashed out in newspaper columns and by politicians and commentators everywhere.
DNA Molecular Structure
From the pioneering work of all the scientists mentioned above and others later on, we now know that
DNA molecules are made up of 4 different types specific chemical substances called nucleobases or nucleosides: These are
Adenine (A), Thymine (T), Guanine (G) and
Cytosine (C). Nucleobases always go by pairs, A with T, and G with C.
Such pairs are known as "base pairs". Biochemist Dr Erwin Chargaff
discovered that the amount of A is always equal to T, and the amount of G is always equal to C in all
human and animal DNA.
In nature all nucleobases occur bonded to a five-carbon sugar molecule
(technically known as 2-deoxyribose sugar molecule),
and one or more phosphate groups, creating a sugar phosphate backbone.
All three make up a single nucleotide which has a double helix structure. The rather
complex way in which
DNA molecules are synthesised in cells was discovered and outlined in detail by biochemists Dr
Severo Ochoa and Dr Arthur Kornberg who received
the 1959 Nobel Prize in Medicine for this discovery. Meanwhile Dr Alexander Todd, a Scottish biochemist did
important work on the mechanics of nucleotides and nucleotide enzymes, for which he received the
1957 Chemistry Nobel Prize.
The double helix physical structure of DNA was earlier determined by American geneticist Dr James Watson and British
biophysicist Dr Francis Crick in 1953.
Watson and Crick based their double helix model largely on the important DNA X-Ray crystallography
work of British physicists Dr Rosalind Franklin and
Dr Maurice Wilkins. Nine years after discovering the double helix structure of DNA, they received the Nobel Prize for
Medicine in 1962. Also in 1964 British chemist Dr Dorothy Crowfoot Hodgkin received the Nobel Prize for
using X-Ray crystallography to discover the physical structure of other biochemical molecules in humans.
Meanwhile in 1982 Lithuanian chemist Dr Aaron Klug received the 1982 Nobel Chemistry Prize for developing the
crystallographic electron microscope that can help scientists view biochemical molecules to some extent.
Today very powerful computer 3D simulations and electron microscopes
alongside X-Ray crystallography,
help boffins work out how biochemical molecules actually look like, since they are just
too tiny to be observed by the human eye or the most powerful optical microscope.
While strong covalent bonding helps keep the whole long chains of repeating DNA strands together (i.e. the Phosphodiester bonds),
the stability of each individual nucleotides is maintained by hydrogen bonding
between A and T, and G and C base-pairs.
No need to look for a biochemistry text: a hydrogen bond is one
of 4 main types of weak non-covalent chemical bonds, it occurs when a hydrogen atom interacts
with electron-attracting atoms such as oxygen or nitrogen. Non-covalent bonds may not be as strong as
covalent bonds, however Non-covalent bonds are very very important in stabilization.
Thus to keep the nucleobases in a single DNA nucleotide structure stable,
non-covalent bonding is the answer, even if these bonds are weak.
While
non-covalent bonding do not share electrons between atoms, covalent bonding involves
electron sharing and it is this electron sharing that makes stronger bonding.
Water is a fine example of covalent bonding between sharing of electrons between
atoms of oxygen and hydrogen.
The other 3 types of weak non-covalent chemical bonding found or used in all living things
(insects, bacteria, plants, animals and humans etc) are Van der Waals forces (molecular attractions that operate over very small distances, based on dipole-dipole interactions),
ionic (electrostatic) attraction (molecular attractions based on static electricity) and hydrophobic bonding
(based on certain molecules like amino acid alanine, hating water so much!!). In this fascinating type of bonding,
nonpolar molecules in a polar solvent (usually water) start to interact (i.e. bind) with one another in a desperate crazy urgency to
avoid water molecules (and deny hydrogen bonding). This is best seen when you pour a table spoon of baby oil into a glass of water.
But hydrogen bonding is the most important non-covalent
bonding found in DNA and proteins, it is also stronger than Van Der Waals forces. Table salt is a fine example of non-covalent bonding (ionic or electrostatic bonding
between
atoms of sodium and chlorine). To recap, in all living things (plants, animals, insects, bacteria etc), the following
are examples of important non-covalent bonding:
a) Holds each of the individual nucleotides, in a DNA double helix structure together (hydrogen bonds).
b) Folds polypeptides structure of proteins into secondary structures as
the alpha helix and the beta conformation (hydrogen bonds).
c) Enables enzymes to work by binding to their substrates (Van der Waals forces).
d) Enables antibodies to bind to specific antigen (Van der Waals forces).
f) Enables hormones to work by binding to their receptors (Van der Waals forces).
g) Permits cell membrane stability, permits the assembly of important biological molecules in our cells such as
ribosomes building up proteins from amino acids as well as eventual protein folding (hydrophobic bonding).
i) Permits spiders and certain lizards like Geckos to practically use pads on their feet to
defy gravity by crawling
up vertical walls or ceilings of buildings as if by magic
(hydrophobic bonding). This feat is often called Nature's Velcro. The
non-covalent bonding forces create electrodynamic attraction between the gecko's or spider's feet and
the surface upon which it is walking. Some scientists say it is actually
Van der Waals forces that allows this feat and not hydrophobic bonding. Ionic / electrostatic bonding is ruled out because
water doesn't affect a gecko's stickiness, which thus nixes the suggestion that
a type of static electricity (i.e. electrostatic bonds) enhances its grip.
Electrostatic bonding, which works best under dry conditions, is the kind of bonding force that
allows a rubbed balloon to stick to a wall.
Certain enzymes (e.g. DNAses), certain chemicals, ultra-violet radiation and nuclear radiation can easily
break the fragile hydrogen bonding and the Phosphodiester bonding of DNA (e.g. by removing the electrons from atoms in the case of hydrogen bonding),
but cells do try to mend the broken hydrogen bonds in DNA whenever they can.
If you are not sure what atoms and electrons are, then you do need a chemistry text.
The above diagram shows the hydrogen bonding (non-covalent bonding) holding individual DNA nucleobases, Adenine (A), Thymine (T),
Guanine (G) and Cytosine (C) together. The enzyme that helps join DNA chains together is called DNA Ligase.
The bond that keeps strands of DNA chains together (covalent bonding) is called Phosphodiester bond. The enzyme that can break up the
Phosphodiester bonds holding DNA chains together is called DNAse.
What is a Gene?
Simple definition: One gene is simply a given length of nucleotides (DNA sequences) on a chromosome or Mitochondria: a gene can be hundreds or thousands of nucleotides in size. Consider hypothetically if all genes were of the same size:
the 3 billion nucleotides (total size of DNA in the human genome) divided by 70,000 genes (total number of
genes in human genome)
is each gene being 42,857 nucleotide base-pairs in size. But of course all genes come in very different sizes, some big and some small.
In genetics 1 kb = 1,000 nucleotide base-pairs and 1mb = 1 million nucleotide base-pairs . A gene that is 500kb in size (that is 500,000 nucleotides ) or more is termed a big gene.
The largest gene in the human genome is
the DMD or dystrophin gene, which is 2300kb or 2.3Mb or 2.3 million nucleotide base-pairs in size. It encodes for the dystrophin protein (a protein found in muscles, that protect them from injury as muscles contract and relax).
The smallest gene in the human genome is histone gene, it is only 500 nucleotide base-pairs in size. It encodes for the histone protein (a protein that condense and package fresh new DNA into a smaller units called nucleosomes and
which protects and stabilises nuclear DNA from damage when not in use).
Cytogenetic Location: long (q) arm of X chromosome position Xp21.2.
All human chromosomes have 2 arms -- a short arm and a long arm -- that are separated from each other only by the centromere, (the point at which the chromosome is attached to the spindle during cell division). By international convention, the short arm is termed the "p arm" while the long arm of the chromosome is termed the "q arm"
Molecular Location: X-chromosome: base pairs 31,119,221 to 33,339,608. If you do the math, that gives
the size of the DMD gene as 2.3 million nucleotides.
Another example:
The OCA2 gene (which gives eye colour in all humans) has a well known location on the chromosome 15 in the human genome.
Cytogenetic Location: the OCA2 gene is located on the long (q) arm of chromosome 15 between positions 11.2 and 12.
Molecular Location: the OCA2 gene is located from base pair 25,673,627 to base pair 26,018,060 on chromosome 15.
What Are The Sizes of Genes found in Nuclear DNA, X and Y Chromosome DNA and Mitochondrial DNA?
First of all a little cell biology lesson: all humans cells all have 23 chromosome pairs (i.e. 46 chromosomes).
Only chromosome pairs 1-22 are called Autosomes,
while chromosome pair 23 are termed sex chromosomes. While chromosome pair 1 is the largest in size,
chromosome pair 23 is the smallest in size.
Sperm and egg cells (known as gametes) only have 23 chromosomes (no pairs here).
In the egg cell, chromosome 23 is always X version.
However in the sperm cell chromosome 23 is either X or Y version. The Y chromosome is very small in size, it is the
smallest of the 23 chromosomes.
During fertilisation when a sperm cell merges with an egg cell, the 23 chromosomes in the sperm
cell recombine with the 23 chromosomes in the egg cell (or crossing over)
to form a zygote cell with 46 chromosomes. This
single zygote cell over 9 months divide millions of times and will grow into a baby. Therefore all the cells of our body right now were are all derived ultimately
from a single zygote cell, that was formed when a sperm fertilises an egg.
If you are still curious about how a single zygote cell becomes a baby in 9 months, I suggest reading the interesting book
The Incredible Unlikeliness of Being: Evolution and the Making of Us
by Alice Roberts. Published in 2015, it is written in the style of popular science so can be enjoyed by readers from all backgrounds.
One fascinating thing about the fertilised zygote cell and development into the early stage embryo, is that it is roughly the same size be it human, mouse, shark, or bear zygote cell or embryo!!
By the time the zygote cell has divided over several thousands times to become an embryo, cell specialisation kicks in: cells start becoming brain, skin, bone and liver cells etc, then form respective tissue and organs. E.g. bones cells develop into bone tissue and liver cells develop into liver.
What starts to differ in say a human and mouse embryos after thousands of divisions
are the active and inactive genes in the cells. For instance mice embryos have active genes such as the Sonic hedgehog gene that are also found in human embryos.
Sonic hedgehog genes tell the various animal and human embryos how, when and where to grow limbs (legs, arms, hands, digits etc). So new-born baby humans always get four tiny human limbs and new-born baby mice always get four tiny mice limbs etc. The inactive genes are a result of evolution as our common fish ancestor originally had only active genes and when fish evolved into amphibians, reptiles and mammals, some genes had to become inactive for obvious reasons. For instance, the genes that make body fur are both similar in human and mouse zygote cells, but remain inactive or switched off in human zygote cells, so human babies are born with no fur. Because the Sonic Hedgehog gene is required for normal limb development in embryos, scientists believe it
stopped working in whales sometime during the last 50 million years. This caused the members of the whale family to lose their hind legs and replace their front legs, or arms, with flippers.
1) With the brief cell biology lesson over, lets now look at the sizes of genes found in Nuclear DNA, X and Y Chromosome DNA and Mitochondrial DNA.
The 23 chromosome pairs in the human genome (Nuclear DNA) are composed of a total of 3,000 million (3 billion) nucleotide
base pairs (i.e. nucleobases) in its 70,000 plus genes. Remember I explained earlier on in this ebook that:
while genes mainly code for proteins (enzymes, hormones etc), many genes do not code for anything at all.
The completed 2003 $2.7 billion Human Genome Project tells us that The human genome has about 70,000 odd genes,
of which just over 30,000 are protein-coding genes. The regions on the chromosome or Mitochondria that have protein-coding regions is called the Exons.
The part with non-protein-coding regions is called the Introns
2) The Y-chromosome possess 60 million nucleotides (or 60mb with roughly 78 genes),
against 153 million nucleotides (or 153mb with 1,098 genes) for the X-chromosome.
If you do the math,
you can easily work out the nucleotide size of the first 22 chromosome pairs by subtracting the
sum of the nucleotide sizes of the X and Y chromosomes from the nucleotide size of the
total 23 chromosome pairs: 3,000 million (3 billion) nucleotides minus (153 million nucleotides +
60 million nucleotides).
3) Mitochondrial DNA consists only of 16,569 nucleotides in its 37 genes! Thats how small its DNA is.
Each human cell has from 2 to 3,500 mitochondria, depending on tissue type, for instance
brain cells which get the biggest amount of energy generated when we eat, have the highest number of mitochondria in a cell.
However..... it just gets better and better: As will be discussed below, most of the mutations that occur in the
MtDNA, take place in a section of the MtDNA known as the D-Loop or Control Region. This region has just over 500
nucleotides in size. So just a short stretch of DNA that is perfect for human ancestry research and population genetics projects: i.e. it is quicker
and cheaper to the read just the sequence of the control region. As an example:
to compare the MtDNA of say the 5,000 year old ancestors of a group of modern people, we just compare the mutation sequences in the
control regions in the MtDNA, of both the 5,000 year old ancestor and that of the modern people.
4th Reason:The Important Issue of Non-Recombining or Non Crossing Over
Finally the fourth reason why MtDNA is special is due to the fact that unlike nuclear DNA (or nDNA),
which each person inherits in a jumbled form from both parents,
mitochondrial DNA IS ONLY passed on only through the mother’s line
This is because while MtDNA occurs in a woman's egg cell, only women pass MtDNA onto their children.
Men can't because the although sperm cells have mitochondria too,
it is located in the sperm's tail not the head of the sperm. Having the Mitochondria in the tail,
helps to power the tails of the sperm cells, and so make the sperm cells move in a fish-like motion.
The tail breaks off, once sperm cell's head enters the egg cell and its nucleus fuses with the mother's egg
cell nucleus forming a single zygote cell nucleus.
The remaining sperm tail then self-destructs, Mission Impossible style!
So in a fertilised egg that becomes a zygote cell and then develops into a baby over 9 months,
the MtDNA is only coming from the mother.
Having MtDNA only inherited from only one parent (i.e. haploid and not diploid),
makes it easy to track mutations as they occur in an orderly linear fashion. Things such as
estimating genetic distances between generations are easy to pinpoint with MtDNA.
In other words, Non-Recombining of DNA IS ESSENTIAL and crucial, if we want to use this DNA for
accurate population genetics projects
or tracing ancestry.
MtDNA is also called Autosomal because it represents DNA not found in the sex chromosomes
i.e. X and Y chromosomes. When two X-Chromosomes (one from each parent) recombines (crossing over) to produce a female zygote cell, all the parts of the
X-chromosome combine with each other. However when X-chromosome (from mother) recombines with Y-chromosome
(from father) to produce a male zygote cell, not all the parts of the
two different chromosomes combine. On the Y-Chromosome is a non-recombining part known as NRY
This part of the
Y-chromosome never recombines, and so is only passed on in males from father to son.
The parts of the Y-Chromosome that DO recombine or carry out crossing over with the X-Chromosome
are called the pseudoautosomal region or PAR.
In the above diagram of the male Y-Chromosome, notice that in-between the two PAR or
(pseudoautosomal regions) on the opposite ends of the Y-Chromosome is
the entire NRY region that does not recombine with the X-Chromosome. The entire NRY region is also called
the MSY region or Male Specific Region and comprises 95% of the X-Chromosome's length.
Only the PAR regions recombine with the X-Chromosome during fertilization (onset of pregnancy).
...You guessed right!! the NRY part of the Y-Chromosome will also be very useful for human ancestry research and population genetics project
since like MtDNA, it is only inherited from either one's mother or father and not both:
inherited from only one parent (i.e. haploid).
In the final analysis, there are two ways in which DNA is changed:
one way is via recombination or crossing over of DNA (during fertilization of egg cell nucleus with sperm cell nucleus, where new DNA recombinations
are randomly created by recombination of DNA from mother and father), the other way is via mutations in MtDNA or Y-DNA. Geneticists
doing ancestry or population genetics research are ONLY interested in the DNA that changes via Mutations.
I will discuss the use of the Y-chromosome NRY region for human ancestry research and population genetics projects
once I conclude the use of MtDNA for human ancestry research and population genetics projects. Read on........
All 6.7 billion people alive today have
inherited the same Mitochondrial DNA from one woman who first lived in Africa
about 200,000 to 300,000 years ago; she has been called Mitochondrial Eve.There were of course hundreds or thousands of other
women alive, alongside Mitochondrial Eve, 200,000 years ago at the same time and place in Africa,
but only this woman's descendants have survived through the maternal line to modern humans today.
She was most likely related to the famous Omo kibish fossils which
are 195,000 years old (discussed previously) . It was her later
descendants who were among the second wave of modern humans who left
In other words, Mitochondrial Eve was not the only female alive at that time, 200,000 years ago;
she was a member of a population of ancient African women, who also had MtDNA types,
but these other MtDNA types ultimately went extinct because the descendants of
these other females either left no offspring or had only male offspring.
This random extinction of lineages, coupled with a single origin of DNA,
is sufficient to guarantee that all of the variation in all of our genes has to
trace back to a single common ancestor at some point in the past.
And even though all of our genes have ancestors, our MtDNA ancestor was not the ancestor
of all of our other genes – they trace their ancestry back to different individuals
(and even different species), living at different times in different places.
In order to study (analyse) MtDNA at particular points, biochemists need to use enzymes that can cut MtDNA at precise spots.
When biochemists want to study DNA, they already know which parts of the long DNA strands they want to study, so before any analysis takes place, they cut the DNA at the points they
want to study.
For this biochemists
need to use special enzymes called Restriction Enzymes.
Restriction Endonucleases (Restriction Enzymes) are enzymes that can cut DNA at or near
specific recognition nucleotide sequences known as restriction sites. As an example,
when geneticists want to study MtDNA for ancestry research, they only need to study the D-Loop (Control Region) portion of MtDNA. To do this they need to use Restriction enzymes that allow them to cut away the MtDNA, at the D-Loop
portions from the rest of the MtDNA. Recall that I explained that most mutation occur in the
D-Loop of MtDNA.
Research into human MtDNA (Mitochondrial DNA) as a genetic marker was first pioneered
by Dr Wesley Brown and
Professor Douglas C Wallace (University of Pennsylvania) in the middle 1970s using
low-resolution restriction enzyme analysis.
The revolutionary use of MtDNA (with very high-resolution restriction enzyme analysis) to discover the genetic proof of
Out of Africa theory and Mitochondrial Eve, was discovered at the prestigious University of California, Berkeley by Professor Allan Wilson and his PhD students, Dr Rebecca Cann and Dr Mark Stoneking.
Professor Wilson was one of the earliest scientists to use molecular biology
and genetic markers to probe the origins of humanity, which culminated in the discovery of Mitochondrial Eve. Their ground-breaking research work titled Mitochondrial DNA and Human Evolution was published in respected Nature journal in 1987
(rumour has it that Nature editors took too long to accept the research paper as they could not believe what they were reading but later on accepted it as fact).
During their research work, they painstakingly analysed mitochondrial DNA
purified from placentas that had been collected from women of many different ancestral origins
(African, Asian and European). By comparing the MtDNA variants to each other, Cann, Wilson and Stoneking produced a phylogenetic tree that showed
how human mitochondria are all related to each other and, by implication,
how all living females, through whom mitochondria are transmitted, are descended
from a single maternal ancestor. Not only that, they localised the root of the tree in Africa.
This tree root was later called the L haplogroup.
As will be explained later, as the mutations found in human MtDNA genomes
are studied, it is possible to draw a tree based on the
common occurrence of the mutations. This tree is known
as a phylogenetic tree. The first phylogenetic tree or L haplogroup was of course the one created by
Cann, Wilson and Stoneking. Over the past 20 years, the phylogenetic tree has been
greatly expanded by other researchers around the world to cover all the major branches of the
phylogenetic tree. More of this discussed later on in this ebook.
MtDNA Molecular Clock and Mutation Rates
Cann, Wilson and Stoneking research work used a technology called MtDNA Molecular Clock, based on
looking at gene mutations rates. Basically DNA Molecular Clocks measures the average rate at which species genome accumulates mutations, to measure their evolutionary divergence and in other calculations.
By knowing how often genes change (mutate), and then counting up the number of genetic differences
between different
species or groups of people, scientists can create a "molecular clock" to decipher
how long ago they shared a
Most Recent Common Ancestor.
Based on their huge research project over several months, Cann, Wilson and Stoneking estimated that from MtDNA Molecular Clock measurements
Mitochondrial Eve lived about 200,000 years ago somewhere in central Africa. This date has since been proved to be very accurate
because, it is backed up
by the astonishing fact that the oldest anatomically modern human fossils are the Ethiopian
Omo kibish fossils dating 195,000 years old (discovered in 1967 by Richard Leakey).
Cann, Wilson and Stoneking research work also concluded that The Mutation Rate for MtDNA is
calculated as
as one major mutation (major SNPs) every 6,000 to 12,000 years.
In others words: The MtDNA as a genetic marker is passed from
generation to generation almost unchanged by mutation for at least 6,000 to 12,000
(roughly about 300 to 600 generations). A mutation rate
is the number of mutations which occur on average per generation.
Mutation rates are determined by comparing the DNA of offspring to parents, and counting up the differences.
It is estimated that humans have about 10 millions SNPs (mutation markers),
across the total population of humans; no single human has all the SNPs.
Geneticists have long discovered that SNPs occur normally throughout a person’s DNA. They occur in humans once in every 300 nucleotides on average,
which means there are roughly 10 million SNPs in the human genome. SNPs will be discussed later in great detail.
Below are two articles about the
sensational 1987 Cann, Wilson and Stoneking research project.
The scientists behind Mitochondrial Eve tell us about the "lucky mother" who changed human evolution forever
Mitochondrial DNA and Human Evolution
This is a link to the famous Professor Allan Wilson, Dr Rebecca Cann and Dr Mark Stoneking research paper (University of California Berkeley) published in the Nature journal in 1987.
It also links various other sources (research papers) used in their project.
BBC Report on Mitochondrial Eve
I have since located the 1988 magazine cover shown below. The Search for Adam and Eve: Scientists Explore a Controversial Theory
About Man's Origins, January 11th, 1988 issue, Newsweek Magazine, (based on the 1987 Cann et al study), written by John Tierney (Newsweek staff writer).
Link to old issue of Newsweek magazine about Mitochondrial Eve.
Review of Newsweek Jan 11, 1988 Article on Mitochondrial Eve
N.B. because the above Newsweek magazine article by John Tierney which was based on a famous university research project (that was sent to Nature journal in 1987) was printed in 1988, Newsweek magazine's
bitter rival Time magazine, was able to publish excerpts (written by Time magazine staff writer Michael D. Lemonic) in early 1987, a full year before the 1988 Newsweek article.
Science section: Everyone's Genealogical Mother
Biologists speculate that "Eve" lived in sub-Saharan Africa. Based on the 1987 Cann et al study, written by Michael D. Lemonic. Time Magazine,
Monday, January 26th, 1987.
The big difference is that while Newsweek chose to make the 1987 Cann at al discovery on Mitochondrial Eve front page splash as seen below,
meanwhile Time magazine article on the 1987 Cann at al discovery on Mitochondrial Eve, was tucked away in the Science Section at page 34.
Human Genetic Variations Today
Today all human MtDNA now show an average of about 50
mutations which have occurred in the 200,000 years
(i.e since Mitochondrial Eve). Some geneticists say that in total it is 120 mutations, not 50 mutations.
Thus the maximum number of MtDNA differences between all humans is 50 (or 120 as other scientists say).
Compared this to the fact that MtDNA genomes in the Neanderthals show an average of about 213
mutations which have occurred in the 350,000 years Neanderthals existed. Clearly Neanderthals had more genetic diversity
than todays humans.
Put in another way, during those 200,000 years modern humans
have gradually but steadily accumulated a maximum of 50 variations in their MtDNA.
The oldest humans, the Kho and San or Khoisan people of South Africa's Kalahari Desert and the Mbo natives of Cameroon,
have the most up to 50, and all other human ethnic groups around the world have fewer.
Humanity's 50 genetic variations have been divided into 36 subunits known as MtDNA haplogroups.
We will discuss more about
what haplogroups are in detail later on in this ebook.
About half of the MtDNA mutations appear to have occurred in approximately
the last 70,000 years, that is after the migration out of Africa.
That over a half of the mutations took place in Africa, shows how old African MtDNA is.
There is another way to look at humanity's amazing 50 genetic variations:
Having just 50 genetic variations in the estimated 200,000 years of modern human history means
that humans have very little genetic
diversity today.
According to the American Journal of Human Genetics (June 2003)
the grounds for the fact that the population of modern human species was at one time drastically
reduced, (70,000 years ago, there were just 10,000 humans), comes from the fact that all humans
have virtually identical DNA, i.e. humans are genetically highly homogenous
(this compares with other mammals like bears which show far greater genetic diversity).
In fact, much greater genetic diversity exists between a small population of chimpanzees in one location
than all of humans around the world.
This is because geneticists tell us that all humans are about 99.9% identical, and
thus differ by just 0.1 % in their DNA (leading to such diversities such as the human ethnic groups).
0.1% is a huge number in cellular genetics. 0.1% of the 70,000 genes in the human genome are 70 genes.
It is these 70 genes that make ethnic groups Europeans, Africans and Asians different from one another in physical appearance ON THE OUTSIDE.
These 70 genes among other things handle skin colour, eye colour, hair texture etc, as well
as very specific features that make it possible to do such things as a DNA test to prove whose
DNA, a blood or saliva sample belongs to, as evident in forensic science and paternity / maternity tests..
Since all humans have 3 billion nucleotide base pairs in their genome, we can also state the fact that
99.9% of our 3 billion base pairs are the same in all people,
with just 0.1% (3 million) being different because of genetic drift, mutations, natural selection, etc.
How do we know about the 99.9%?
When the $2.7 billion Human Genome Project had been completed officially in April 2003 it showed one
surprising fact: Any two unrelated people are 99.9 percent identical at the genetic level.
Ex-president Bill Clinton who was president of the U.S. when the $2.7 billion Human Genome Project officially began in 1993,
acknowledged in a 2000 speech
that "All human beings, regardless of race, are 99.9 percent the same".
The Concept of Race As Purely A Social Construct
Anthropologists Professor Nina Jablonski and Dr George Chaplin did a big research project on skin colour variation
that concluded that all human skin colours are not due to race but adaptation to life under the sun.
One of the important implications of Jablonski and Chaplin's work
is that it underlines the emerging fact about concept of race as purely a social construct, with no scientific merits (in other words race is a social concept, not a scientific one). However the word "race" is not going to walk away in the modern world, it will continue to confuse us for generations to come, even though DNA research has shown that genetically all humans, regardless of skin colour and other
surface distinctions, are basically the same 99.9%. The fact that just 70 genes separates one human from another, shows why humans today,
have very little genetic diversity.
A Question of Race: when the word "race" was invented a long time ago, we did not know much about our DNA. Today we now
know so much about our DNA and so the word "race" is kinda invalid. "Ethnic groups" is a much better term.
As noted earlier on, just over 70 genes make the ethnic groups Europeans,
Africans and Asians different from one another in physical appearance ON THE OUTSIDE.
How is a Mutation in MtDNA Spotted??
Most of the frequent high mutation or error rates are thought to occur exclusively in the non-coding portion of mitochondrial DNA,
known as the MtDNA control region or the D-Loop.
When Cann, Wilson and Stoneking discovered that most of the mutations in MtDNA occur in the
D-Loop or Control Region, it became clear to them that it was much quicker
and cheaper to the read just the sequences of the control region instead of the sequences in the whole MtDNA. As an example:
to compare the MtDNA of say the 5,000 year old ancestors of a group of modern people, we just compare the mutation sequences in the
control regions in the MtDNA, of both the 5,000 year old ancestor and that of the group of modern people.
Mutations in MtDNA are easily located by looking for what
geneticists term substitutions. To understand this we need to take a good look at how MtDNA
looks like:
By the way, as the diagram above shows, MtDNA is circular in shape.
The 37 genes of MtDNA outside the D-Loop codes for two rRNAs, 22 tRNAs and 13 polypeptides (small proteins).
The Hypervariable Regions in the above diagram i.e. HVR1 and HVR2
are locations within the D-loop of
mitochondrial DNA in which base pairs of nucleotides have very frequent Substitutions. In other words,
whenever a mutation has occurred in MtDNA D-Loop, substitution of base pairs of nucleotides has occurred.
Mutations (substitutions) also occur outside the D-Loop of mitochondria.
Hypervariable Regions do not code for any functional genes and when
mutations occur very little bad stuff occurs, thus Hypervariable Regions are the best hunting places for population genetics studies.
There are actually 3 Hypervariable Regions because HVR3 is not shown above. But HVR1 and HVR2 have been studied more extensively.
When a person submits their MtDNA for DNA ancestry testing, the tests can either use the whole MtDNA or just the MtDNA D-Loop.
For instance the test known as mtFullSequence (FMS, FGS) is a complete MtDNA test, providing detailed information on
haplogroups (haplogroups will be explained later on in this eBook). Meanwhile the test known as mtDNAPlus
only uses the MtDNA HVR1 and HVR2 hypervariable regions and only gives basic haplogroup information.
Lets now turn to spotting mutations in MtDNA. Take for instance, if the sequence of a portion of MtDNA HVR1 in 2,000 year old male is
CCAATTTATTCGAAACC and one of his great, great, great, great, great, great, great grandsons has the sequence in his MtDNA HVR1
as CCAATTTATTCGCAACC. Then a single mutation has occurred, because
base-pair A-T has been substituted for base-pair C-G, when comparing both portions of sequences.
Incidentally, Hypervariable Regions also occur in Nuclear DNA as well!
but not only Substitutions, but also what is known as Repeats and Deletions as well. When a
Repeat mutation occurs, a sequence of nucleotides on Nuclear DNA simply repeats itself (inserts repeats of nucleotide base-pairs). One type of repeat mutations is
called Short Tandem Repeats or STR. We will read more about how STRs in the part of Section E titled "The Big DNA TEST!"
Deletion mutations occurs when a sequence of nucleotides on nuclear DNA simply goes missing.
Geneticists call insertions or deletions of Nuclear DNA INDELS,
there are just over 26,000 indels in the human genome! (i.e. the 3 billion nucleotide base pairs in nuclear DNA have over 26,000 indels).
Despite this, as explained earlier on MtDNA have much higher mutation rates than nuclear DNA.
Substitutions (MtDNA & Nuclear DNA) or Repeats and Deletions (Nuclear DNA only) in the
hypervariable region are highly polymorphic. The main reason why frequent
high mutation or error rates occur in the D-loop, in the case of MtDNA.
Mitochondrial DNA Diseases
The D-loop in MtDNA does not code for any major functional genes, BUT
the rest of the MtDNA DOES code for genes. As noted earlier on, mitochondria is involved in generating energy for cells. Thus most of the
genes in mitochondria hence code for the enzymes (which are proteins) involved in the Electron Transport Chain (i.e. Oxydative Phosphorylation), to generate ATP molecules. Geneticists have estimated that
the majority of the genes outside the Mitochondria's D-Loop code for only 13 different proteins.
When mutations (substitutions)
occur in MtDNA D-Loop
very few bad stuff occurs, just a nice good marker spot for tracking ancestry. However when mutations (substitutions)
occur in any parts of the MtDNA outside the D-Loop, mitochondrial DNA diseases may happen. Diseases do happen when mutations occur in
MtDNA D-Loop, especially cancers. But because the DNA in the MtDNA D-Loop is so small (just 500 nucleotide base-pairs in length and no genes)
compared to the whole of MtDNA (16,569 nucleotide base-pairs and 37 genes), diseases caused by mutations in
MtDNA D-Loop are limited in scope. Far more serious mitochondrial diseases occur outside MtDNA D-Loop than inside the D-Loop.
Scientists have discovered that on rare
occasions, severe mitochondrial diseases including some forms of hearing impairments, brain damage,
muscle wasting, and diabetes, have been associated with mutations on MtDNA, (outside the D-Loop). In another example, Professor Douglas C Wallace at Emory University Medical School
in the 1980s discovered that mutations in MtDNA (outside the D-Loop) can cause the
inherited human disease, Leber Hereditary Optic Neuropathy. In other to prevent mitochondrial diseases, in
2015, Britain may be the first to use
techniques to correct mutations in MtDNA for future generations via the Human Fertilisation and
Embryology (Mitochondrial Donation) Regulations 2015.
The 2015 regulation dubbed Three-Parent Babies by mainstream media, has caused much confusion among
members of public who think MtDNA is part of nuclear DNA and the 2015 regulation
simply wants to modify a person's genome, which is of course just unethical.
But this is not the case, since MtDNA is in no way related to nuclear DNA and
so modifying MtDNA does not modify a person's genome. The new technique is being researched
by boffins at the University of Newcastle. Basically it involves removing all the mitochondria or cytoplasm
in a female patient's egg cell (about 100 plus mitochondria exist in a single egg cell, most human
cells may house anywhere from 2 to 2,500 mitochondria, depending on tissue type), and
inserting about 200 plus new mitochondria or cytoplasm from a healthy female donor, (using a technique called ooplasmic transplantation).
Next IVF or (in-vitro fertilisation) is used to fertilise the modified egg cell in a test-tube (containing
both patient's nuclear DNA and donor's MtDNA)
with partner's sperm cells. Another but more easier method is to gently remove the entire nucleus from the female patient's egg cell
and insert it in a donor's egg cell (whose nucleus has already been gently removed) then follow up with IVF.
The mitochondria in sperm cell tails always remains outside the egg cell after fertilisation and the sperm tail self destructs. Ooplasmic transplantation and subsequent IVF are very delicate procedures and time-consuming and
like the birth of the world's first test tube
baby (Louise Brown) born via IVF treatment invented by Dr Robert Edwards in 1978 in Britain, "Three-person babies"
will be another British first and important milestone when the first baby is born via modified
MtDNA.
Unfortunately when mutations (e.g. repeats and deletions, substitutions) occur in nuclear DNA, and they do occur every now and then,
much worse things do happen, such as more severe genetic diseases like Down's Syndrome,
which is caused by having an extra copy of chromosome 21, (i.e. repeats of nucleotides in
chromosome 21). If an extra copy occurs on chromosome 23 (the X-chromosome) in a male, it leads to a genetic condition
known as Klinefelter's Syndrome in which a male has a whole extra copy of his X chromosome, such a male
has X-X-Y sex chromosomes instead of the normal X-Y sex chromosomes.
What is Single Nucleotide Polymorphism or SNP?
In 1965, when the use of DNA to trace human ancestry was at its infancy, Stanford University Professor Emeritus Luigi Luca Cavalli-Sforza and his colleagues had used classical
genetical data such as human proteins and blood groups in attempt
to use genetical data on human ancestry research and population genetics projects.
In this case analyses of the changes in polymorphisms sites, (i.e. markers or mutations) in proteins and blood groups was carried out.
In the case of DNA analysis, when it finally became available, geneticists
again look for markers or mutations in the MtDNA, known as
SNP or single nucleotide polymorphism sites. In the above example of a section of the MtDNA in 2,000 year old male (CCAATTTATTCGAAACC),
a mutation in a single base pair had occurred (the base pair A-T is switched to C-G) leading to CCAATTTATTCGCAACC. This
single base pair is called a Single Nucleotide Polymorphism, or SNP.
Therefore each base-pair site on MtDNA D-loop sequence
that contain a single substitution is known as a SNP site. Single Nucleotide Polymorphism sites
are the very markers in a MtDNA sequence that point where a mutation has occurred. How and why
these mutations occur is still being investigated in research labs worldwide.
It is estimated that humans have about 10 millions SNPs,
across the total population of humans; no single human has all the SNPs.
Geneticists have long discovered that SNPs occur normally throughout a persons DNA. They occur in humans once in every 300 nucleotides on average,
which means there are roughly 10 million SNPs in the human genome. Most commonly, these variations are found in the DNA between genes.
They can act as migration makers, helping geneticists plot the route taken by our human ancestors as they migrated out of Africa 70,000 years ago.
SNPs also act as biological markers, helping scientists locate genes that are associated with disease.
When SNPs occur within a gene or in a regulatory region near a gene, they may play a more direct role in disease by affecting the gene’s
function.Most SNPs have no effect on health or development. Some of these genetic differences, however, have proven to be very important in the
study of human health. Researchers have found SNPs that may help predict an individuals response to certain drugs, susceptibility to environmental
factors such as toxins, and risk of developing particular diseases. SNPs can also be used to track the inheritance of disease genes within families.
Future studies will work to identify SNPs associated with complex diseases such as heart disease, diabetes, and cancer
Examples of Good and Bad Mutations in Humans
NEW UPDATED DATA This section was updated with brand new examples of good and bad mutations.
There are over 5,000 fascinating examples of good and bad mutations in humans today. Let's look at eight of them, I will add more in the future. There are more good mutations than
bad mutations because evolution (alongside Natural Selection) favours good mutations: recall at the very start of this ebook I mentioned if a mutation
creates advantage, it will thrive, driving evolution. But remember that people with beneficial mutations are not mutant X-men!!
1) Lactose Tolerance
An example of a good mutation in nuclear DNA is already noted in this ebook, is the evolution of the LCT gene
for lactose tolerance (the ability to digest milk in adulthood). In this case no substitution or
deletion of nucleotide base-pairs has occurred (i.e leading to changes in amino acid arrangement of the gene's
expression of its protein). Put simply the gene for lactose tolerance was switched on, having been switched
off, naturally by another gene known as MCM6, as some genes in the human genome control
other genes. Before the advent of agriculture, the LCT gene for lactose tolerance was naturally switched off by
MCM6 gene, just after weaning in a child (child moves on to solid food entirely).
But after agriculture, in particular diary farming, arrived and lots of adults began drinking milk,
something happened. Evolution via Natural Selection
caused the LCT gene for lactose tolerance to be activated by the MCM6 gene in adulthood. The Lactase enzyme which was normally dormant
in adults, was suddenly switched on, i.e. activated.
Lactase is the enzyme produced in the digestive system of lactose tolerant humans, essential for the
complete digestion of
fresh whole milk sugar (known as lactose). Scientists say that lactose tolerance in adults is the most
spectacular mutation in recent human history.
What happened was that
after several repeated incidents of adults getting sick with diarrhoea after drinking milk,
over thousands of years, evolution said
enough is enough and decided to do something about it. Evolution whose primary goal is survival and well-being of a species
caused the LCT gene for lactose tolerance to remain switched on in adulthood, who could now resume drinking milk and not
fall sick again.
The Most Spectacular Mutation in Recent Human History
Unfortunately, not everyone has this good mutation. Millions of
adults around the world still cannot drink, hence digest milk properly, and get tummy upsets and diarrhoea after
drinking whole milk in large quantities (the milk they drink simply goes undigested
and begin to go sour in their guts due to fermentation by bacteria). This is particularly true in west and central Africa where diary farming was only
introduced around the late middle ages by the Arabs, (east African ethnic groups such as the Kikuyu in Kenya have the mutation because their ancestors have been the drinking milk of cattle for thousands of years). It was thus too late by then for natural selection
to give today's West Africans lactose tolerance mutation, because at least 3000 years was needed
before lactose tolerance mutation manifested itself
in Europe and Western Asia, where diary farming was invented much much earlier. But some West African adults
are lactose non-persistence: they retain some lactase activity and can eat or drink certain dairy products
such as yogurt and cheese. These products have a reduced lactose content because fermentation, which is used
to make yogurt and cheese breaks down much of the lactose in these diary products.
N.B. About 1% of babies born worldwide, have a faulty LCT gene. They develop congenital lactase
deficiency or congenital alactasia. They are unable to digest the lactose in their mother's milk or normal infant milk formula
and need to be given special lactose-free infant formula or they will get diarrhoea and dehydration. In babies
with congenital alactasia, their
faulty LCT gene does not code for a normal working lactase enzyme, but an impaired lactase enzyme that does not
breakdown lactose properly.
2) Human Speech
Another good example of a good mutation in nuclear DNA is human speech. Even if chimpanzees had vocal cords in the same design as humans, they still would not be able to
speak in different languages as humans can. Thanks to a good mutation in the Human form of the FOXP2 gene, humans can speak different languages.
As we know, genes code for proteins. When a gene experiences a mutation, its nucleotide base-pairs are rearranged. This in turn will lead to rearrangement of the amino acids of the protein, the gene produces. The protein produced by a mutated
gene is thus very different from one produced by a normal gene. The FOXP2 gene codes for the FOXP2 protein. The mutation in the human FOXP2 gene found in brain cells caused humans to have a different form of the FOXP2 protein and it is this protein molecule
that gives humans the ability to speak different
languages (how the FOXP2 actually works is too complicated to explain here). Chimpanzees do not have this mutation, so have a different type of FOXP2 gene, allowing
only wailing
and growling sounds and not full speech. Had this good mutation occurred in
FOXP2 gene of chimpanzees as well, then of course they would have been able to perform some form of speech.
The FOXP2 protein in humans and chimpanzees differs
(via mutation) by the substitution of just two amino acids. The amino acid Threonine is
substituted for the amino acid Asparagine at position 303 (T303N)
and Asparagine to Serine substitution at position 325 (N325SA) on the human genome.
TRY THIS: To find out
which two nucleotide base-pairs got substituted in the mutated gene that codes for the Human FOXP2 protein
(we are talking Single Nucleotide Polymorphism here!) use the Genetic Code
table given below (see "How Cracking The Genetic Code Helped MtDNA Research).
3) Sickle Cell Anaemia AND Resistance to Malaria
When a mutation is bad, it leads to genetic diseases, as noted earlier on by the fact that
Down's Syndrome is caused by having a mutation on chromosome 21 (an extra copy of chromosome 21 occurs).
Another unfortunate example of bad mutation is sickle cell anaemia. This occurs when the
haemoglobin HBB gene in red blood cells mutates and produces faulty haemoglobin molecules. This happens because
the haemoglobin protein in sickle cell anaemia victims has its amino acid Glutamic Acid substituted with the
amino acid Valine.
TRY THIS: To find out
which nucleotide base-pairs got substituted in the mutated gene that codes for the Human haemoglobin protein
(we are talking Single Nucleotide Polymorphism here!) use the Genetic Code
table given below (see "How Cracking The Genetic Code Helped MtDNA Research).
Hint:
The resulting faulty haemoglobin causes red blood cells to be sickle-shaped and
unable to transport oxygen properly to other cells (haemoglobin is the iron-rich protein that enables red blood cells to carry oxygen). Normal red blood cells are disc-shaped, not sickle-shaped,
because sickle-shaped red blood cells are unable to move around as easily as normal shaped red blood cells.
Because sickle cell anaemia is a genetic disease, the faulty HBB gene
is easily passed through generations.
Sickle Cell Anaemia is a fine example of evolution paradox in nature. It began to occur
due to the human body's immune system response to several repeated incidents of severe malaria over thousands of years:
the sickle cell haemoglobin somehow confers a survival advantage against malaria!!
Malaria itself (whose causes were discovered by 1902 Nobel Prize winner Ronald Ross) will soon become a thing of the past with a vaccine on the way. But there is no such cure for Sickle Cell Anaemia.
But here is the beneficiary of the Sickle Cell Anaemia evolution paradox: Alleles are alternative versions of a gene. Individuals carrying two copies of
sickle cell mutation allele (inherited from both the father and mother) always develop sickle cell anaemia. Meanwhile individuals carrying just one copy of
the sickle mutation allele (i.e. inherited from either the father or mother) DO NOT develop sickle cell anaemia,
so lead rather normal lives. Remarkably scientists discovered that these same individuals,
(who thus carry the sickle cell trait), were in fact highly protected against malaria. Likewise individuals with
Sickle Cell Anaemia are also highly protected against malaria, though at the cost of having Sickle Cell Anaemia.
Thus explaining the high prevalence of this mutation in geographical areas where malaria is highly endemic such as
the yearly warm and wet areas of Sub-Saharan Africa and southeast Asia.
What happened was that after several repeated incidents of malaria over thousands of years, evolution said
enough is enough and decided to do something about it. Evolution whose primary goal is survival of a species
caused the HBB gene to mutate and produce a different haemoglobin. This in turn produced red blood cells
that became resistant to the malaria plasmodium parasite. But this in turn led to
Sickle Cell Anaemia for those with two copies of
sickle cell mutation allele. Sickle Cell Anaemia is an example of Inherited Autosomal Recessive Trait
meaning that a child needs to inherit a copy of the defective gene from BOTH parents to be affected with the disease.
In evolution you win some and you lose some.
Dr Niobe Thompson in the documentary TV programme The Great Human Odyssey
noticed that people (adults and kids) living near the Sepik River villages in Papua New Guinea never catch malaria,
even though that place is rife with malaria mosquitoes! An outside visitor to the Sepik River villages would contract severe malaria in a matter of days.
It turns out that most Sepik River people have the highly protective sickle cell trait: they are 100% immune to malaria and also do not have any
sickle cell anaemia. Once again we witness evolution in action,
allowing Sepik natives to survive the most malaria infested place on earth.
BREAKING NEWS: In March 2017, the journal Nature Biotechnology reported that French biochemists,
using pioneering molecular biology techniques based on Gene Therapy
were able to genetically change the gene in the bone marrow of a Sickle Cell disease patient in a way that it started to reproduce normal haemoglobin and ceased making
mutated haemoglobin. Gene Therapy is fast becoming a way scientists can change faulty mutated genes! But the technology known as gene therapy is not limited to treating adults and children.
In August 2017, Professor Juan Carlos Izpisua and Dr Jun Wu at the famous Salk Institute in the U.S. were able to alter faulty genes in human embryos!!
The faulty genes had a mutation that caused several genetic diseases. I discuss more about this below, see the sub-heading: "Babies and Mutations."
4) Heart Disease
Heart disease is one of the scourges of industrialised countries. It's the legacy of an evolutionary past which programmed us to crave energy-dense fats, once a rare and valuable source of calories, now a source of clogged arteries. But there's evidence that evolution has the potential to deal with it. All humans have a gene for a protein called Apolipoprotein AI, which is part of the system that transports cholesterol through the bloodstream.
Apo-AI is one of the HDLs or High Density Lipoproteins, already known to be beneficial because they remove cholesterol from artery walls.
But a small community in Italy is known to have a mutant version of this protein, named Apolipoprotein AI-Milano, or Apo-AIM for short.
Apo-AIM is even more effective than Apo-AI at removing cholesterol from cells and dissolving arterial plaques, and additionally
functions as an antioxidant, preventing some of the damage from inflammation that normally occurs in arteriosclerosis.
People with the Apo-AIM gene have significantly lower levels of risk than the general population for heart attack and stroke,
and pharmaceutical companies are looking into marketing an artificial version of the protein as a cardioprotective drug.
While most of us have to worry about limiting our intake of fried foods, bacon, eggs, or anything that we are told is on the cholesterol-raising list of the
moment, a few people can eat all these things and more without fear. In fact, no matter what they consume,
their “bad cholesterol” (blood levels of low-density lipoprotein, associated with heart disease) remains virtually non-existent.
These people were born with a genetic mutation in a gene called PCSK9 . More specifically, they lack working copies of a gene known as PCSK9,
and while it’s usually unlucky to be born with a missing gene, in this case, it seems to have some positive side effects.
After scientists discovered the relationship between this gene (or lack thereof) and cholesterol about 10 years ago, drug companies have worked frantically to create a pill that would block PCSK9 in other individuals. The drug is close to getting FDA approval. In early trials, patients who have taken it have experienced as much as a 75-percent reduction in their cholesterol levels.
So far, scientists have only found the mutation in a handful of African Americans, and those with it have the benefit of a 90-percent reduced risk of heart disease.
5) Tetrachromatic vision
Most mammals have poor colour vision because they have only two kinds of cones, the retinal cells that discriminate different colours of light. Humans, like other primates, have three kinds, the legacy of a past where good colour vision for finding ripe, brightly coloured fruit was a survival advantage.
The gene for one kind of cone, which responds most strongly to blue, is found on chromosome 7. The two other kinds, which are sensitive to red and green, are both on the X chromosome. Since men have only one X, a mutation which disables either the red or the green gene will produce red-green colourblindness, while women have a backup copy. This explains why this is almost exclusively a male condition.
But here's a question: What happens if a mutation to the red or the green gene, rather than disabling it, shifts the range of colours to which it responds? (The red and green genes arose in just this way, from duplication and divergence of a single ancestral cone gene.)
To a man, this would make no real difference. He'd still have three colour receptors, just a different set than the rest of us. But if this happened to one of a woman's cone genes, she'd have the blue, the red and the green on one X chromosome, and a mutated fourth one on the other... which means she'd have four different colour receptors. She would be, like birds and turtles, a natural "tetrachromat", theoretically capable of discriminating shades of colour the rest of us can't tell apart. Does this mean she'd see brand-new colours the rest of us could never experience? That's an open question.
And we have evidence that just this has happened on rare occasions. In one study of colour discrimination, at least one woman showed exactly the results we would expect from a true tetrachromat
6) Survival in Very Harsh Cold Weather
The Inuits (Eskimos) and Aleuts and other indigenous populations reached and settled in the Arctic regions as well as other
populations who live in intensely cold environments have adapted to an extreme way of life. Have these people simply
learned how to survive in these environments, or are they somehow biologically different?
Cold-dwellers have different physiological responses to low temperatures compared to those who live in milder environments. And it appears there might be at least a partial genetic component to these adaptations, because even if someone moves to a cold environment and lives there for decades, their bodies never quite reach the same level of adaptation as natives who have lived in the environment for generations. For instance, researchers have found that indigenous Siberians are better adapted to the cold even when compared to non-indigenous Russians living in the same community.
People native to cold climates underwent good mutations thousands of years ago to enable them to have higher basal metabolic rates
(around 50 percent higher) than those accustomed to temperate climates. Also, they can maintain their body temperatures better without
shivering and have relatively fewer sweat glands on the body and more on the face. In one study, researchers tested different ethnic groups to see how their skin temperatures changed when exposed to cold. They found that Inuits were able to maintain the highest skin temperature of any group tested, followed by other Native Americans.
These types of evolutionary adaptations partly explain why aboriginal Australians can sleep on the ground during cold nights
(without shelter or clothing) with no ill effects and why Inuits can live much of their lives in subzero Arctic temperatures.
While Antarctica is the coldest uninhabited place on earth (save for research stations), Yakutia (Sakha Republic) is home to the coldest inhabited place on earth.
Yakuta is located in the
North eastern part of Russia (northern parts of Russia's Arctic regions). Just as in the case of the
Inuits (Eskimos) and Aleuts, and other indigenous populations of the Arctic regions, The Yakuts of Yakutia have benefited from
thousand years of evolution and natural selection making them adapt to adapt to extreme cold weather.
All these indigenous populations
settled in the Arctic regions near the north pole (indigenous populations of
northern Alaska, northern Canada, northern Greenland and northern Siberia) around or just after AD
1000. Thus over a thousand years later evolution and natural selection has completely kicked in and has allowed these
indigenous populations to survive in these very cold places. Anyone whose ancestry is outside the
Arctic regions will simply struggle to survive here, as our bodies have not been able to adapt to extreme cold weather as the Inuits (Eskimos) and Aleuts have.
For instance the indigenous populations are stocky in build (a cold weather adaptation created by evolution, as seen in the Neanderthals who had to survive the Ice Ages in Europe) and
under their skin are much bigger layers of healthy fat to insulate them against very cold weather.
These guys can eat lots of fatty food rich in cholesterol and never get heart disease, thanks to evolution.
Amazingly, the human body is much better suited at adjusting to heat than to cold, so it’s rather impressive that people manage to live at all in freezing temperatures, let alone thrive. AND NO...these guys are not mutant X-men!!
7) Human Tolerance to Hypoxia or Evolutionary Adaptation to Living in High Altitudes
Most climbers who’ve made it to the summit of Mt. Everest wouldn’t have done so without a local Sherpa guide. Amazingly, Sherpas often travel ahead of the adventurers to set ropes and ladders, just so the other climbers have a chance of making it up the steep cliffs.
There’s little doubt that Tibetans and Nepalese (as well as residents of many towns in Chile, Peru and Bolivia such as La Rinconada) are physically superior in this high-altitude environment, yet what is it exactly that allows them to work vigorously in oxygen-depleted conditions, while ordinary folks have to struggle just to stay alive?
Tibetans live at an altitude above 4,000 meters (13,000 ft) and are accustomed to breathing air that contains about 40 percent less oxygen than at sea level. Over the centuries, via good mutations, their bodies compensated for this low-oxygen environment by developing bigger chests and greater lung capacities, which make it possible for them to inhale more air with each breath.
And, unlike lowlanders whose bodies produce more red blood cells when in low oxygen, high-altitude people have evolved to do the exact opposite—they produce fewer red blood cells. This is because while an increase in red blood cells might temporarily help a person get more oxygen to the body, it makes blood thicker over time and can lead to blood clots and other potentially deadly complications. Similarly, Sherpas have better blood flow in their brains and are overall less susceptible to altitude sickness.
Even when living at lower altitudes, Tibetans still maintain these traits, and researchers have found that many of these adaptations aren’t simply phenotypic variances (i.e., would reverse at low altitudes) but are genetic adaptations. One particular genetic change occurred in a stretch of DNA known as EPAS1, which codes for a regulatory protein. This protein detects oxygen and controls production of red blood cells and explains why Tibetans don’t overproduce red blood cells when deprived of oxygen, like ordinary people.
The Han Chinese, the lowland relatives of the Tibetans, do not share these genetic characteristics. The two groups split from each other about 3,000 years ago, which means these adaptations occurred in only about 100 generations—a relatively short time in terms of evolution.
8) Less Sleep Than The Average Person
If it ever seems like some people have more hours in their day than you do, it turns out they just might—at least more awake hours. That’s because there are unusual individuals who can operate on six or fewer hours of shut-eye a night. And they aren’t simply getting by—they thrive on this limited amount of sleep, while many of the rest of us are still dragging ourselves out of bed after snoozing for eight solid hours.
These people aren’t necessarily tougher than the rest of us, and they haven’t trained their bodies to function on less sleep. Instead,
they have a rare genetic mutation of the gene DEC2, which causes them to physiologically need less sleep than the average person.
If normal sleepers were to stick to six or fewer hours of slumber, they’d start experiencing negative impacts almost immediately.
Chronic sleep deprivation can even lead to health problems, including serious ones like high blood pressure and heart disease.
People with the DEC2 mutation don’t have any of the problems associated with sleep deprivation, despite the limited time their heads are on the pillow. While it might seem odd that a single gene could change what we believe is a basic human need, those studying the DEC2 mutation believe it’s helping people to sleep more efficiently with more intense REM states. Apparently, when we have better sleep, we need less of it.
This genetic anomaly is exceedingly rare and is only found in less than 1 percent of self-proclaimed short-sleepers. So, chances are, even if you think you have it, you probably don’t.
Babies and Mutations
Recall that every time a human cell divides, mistakes in genes can creep in (i.e. new mutations). A single zygote diploid cell soon develops into an embryo and a baby in 9 months. During this time cells in an embryo
would have divided several millions of times by the time a baby is due. But unfortunately some mutations (bad) have occurred here and there along the way.
Some are harmless and will do no harm to the baby as he or she grows into an adult, but a few rare ones are not and need to be remedied at birth.
Since mutations (bad) are also passed on from generations to generations, even if a baby is born with no harmful obvious mutations, his or her parents might have
passed on a mutation. Even if both parent are healthy from a genetic point of view, recall that some genetic diseases are termed Inherited Autosomal
Recessive Traits, meaning that a new born baby needs to inherit a copy of the defective gene from BOTH parents to be affected with a genetic disease,
that was not evident in parents of the baby. For instance both parents might not have Sickle Cell Anaemia at all, but their baby is born with Sickle
Cell Anaemia, because it is an Inherited Autosomal Recessive Trait. Another example is seen in mitochondrial DNA.
All human cells such as muscle cells,
have a fixed amount of mitochondria, this also means all human cells have a fixed amount of mitochondrial DNA. To maintain a fixed amount of mitochondrial DNA,
a mechanism exists in the enzymes that make copies of mitochondrial DNA on a regular basis in cells. In very rare instances, a baby sometimes born with
a mutation in which a there is a reduction in the ability to maintain regular copies of mitochondrial DNA in cells such as muscle cells. Over a period of time,
cells in the baby will begin to
have a reduction in the overall amount of mitochondrial DNA, as not enough copies are not being made long term. If not treated, such depletion in the amount of
mitochondrial DNA will lead to a hard to treat disorder called Mitochondrial DNA Depletion.
When this happens in muscle cells, they start to waste away tragically for the baby. Mitochondrial DNA Depletion is also an Inherited Autosomal Recessive Trait, i.e.
both parents might not have Mitochondrial DNA Depletion at all, but their baby is born with Mitochondrial DNA Depletion.
Several public health services around the world, notably in Europe and the U.S. on a routine basis test new born babies for common genetic conditions, using methods such as
heel-prick test or blood spot screening for five and eight days old babies. This is done to check for:
a) Congenital hypothyroidism or CHT. Babies do not have enough of the hormone thyroxine.
b) Sickle cell disease.
c) Cystic fibrosis.
d) Congenital lactase deficiency or Congenital alactasia. Babies are unable to digest the lactose in their mother's milk or normal infant milk formula and need to be given special lactose-free infant formula or they will get diarrhoea and dehydration. In babies with congenital alactasia, their faulty mutant LCT gene does not code for a normal working lactase enzyme.
e) Medium-chain acyl-CoA Dehydrogenase Deficiency or MCADD. Babies unable to carry out fatty acid oxidation i.e. break down medium-chain fatty acids into acetyl-CoA.
f) Mitochondrial DNA Depletion. Babies unable to make enough Mitochondrial DNA in thier cells. Currently only Switzerland, the U.S. and Japan have the advanced medical expertise to test and treat this genetic condition,
as the disease is very rare and also very hard to detect in new born babies. I discuss more about mitochondrial DNA Depletion below
g) Phenylketonuria or PKU Babies unable to break down amino acid called phenylalanine.
h) Maple Syrup Urine Disease or MSUD. Babies unable to break down the branched-chain amino acids such as leucine, isoleucine and valine.
i) Homocystinuria (Pyridoxine unresponsive) or HCU. Babies unable to break down amino acid methionine.
j) Glutaric acidaemia type 1 or GA1. Babies unable to break down the amino acids lysine, hydroxylysine and tryptophan.
k) Isovaleric acidaemia or IVA. Babies with IVA are unable to fully break down the amino acid leucine.
Normally, leucine is broken down into a chemical substance called isovaleric acid, which is then broken down and converted into energy (makes ATP molecules).
Babies with IVA do not have the enzyme that breaks down isovaleric acid.
The last six (g-k) are also called inherited protein metabolic diseases and
are due to missing or defective amino acid enzymes, all caused by mutated genes (bad mutations).
Normally in adults, their digestive systems break down protein foods like meat, chicken, pork and fish into amino acids.
Any amino acids that aren't needed are usually broken down into harmless by-products by our enzymes and then removed from the human body via urine,
faeces and sweat etc. Without these enzymes, the excess amino acids will begin to dangerously accumulate in the blood leading to very serious health issues.
Mitochondrial DNA Depletion
All human cells such as muscle cells,
have a fixed amount of mitochondria, this also means all human cells have a fixed amount of mitochondrial DNA. To maintain a fixed amount of mitochondrial DNA,
a mechanism exists in the enzymes that make copies of mitochondrial DNA on a regular basis in cells. In very rare instances, a baby is sometimes born with
a mutation in which a there is a reduction in the ability to maintain regular copies of mitochondrial DNA in cells such as muscle cells. Over a period of time,
cells in the baby will begin to
have a reduction in the overall amount of mitochondrial DNA, as not enough copies are not being made long term. If not treated, such depletion in the amount of
mitochondrial DNA will lead to a hard to treat disorder called Mitochondrial DNA Depletion.
When this happens in muscle cells, they start to waste away tragically for the baby. Mitochondrial DNA Depletion is caused by a
mutation in the gene that codes for the enzyme known as
Thymidine Kinase 2 or simpy TK2. When the TK2 gene is working normally, it produces healthy Thymidine Kinase 2 enzymes
that helps to maintain normal amounts of
mitochondrial DNA. Scientists are not sure what exactly causes very rare instances of mutated TK2 genes. Research is ongoing to find out what causes the mutations.
Mitochondrial DNA Diseases
The D-loop in MtDNA does not code for any major functional genes, BUT
the rest of the MtDNA DOES code for genes. As noted earlier on, mitochondria is involved in generating energy for cells. Thus most of the
genes in mitochondria hence code for the enzymes (which are proteins) involved in the Electron Transport Chain (i.e. Oxydative Phosphorylation), to generate ATP molecules. Geneticists have estimated that
the majority of the genes outside the Mitochondria's D-Loop code for only 13 different proteins.
When mutations (substitutions)
occur in MtDNA D-Loop
very few bad stuff occurs, just a nice good marker spot for tracking ancestry. However when mutations (substitutions)
occur in any parts of the MtDNA outside the D-Loop, mitochondrial DNA diseases may happen. Diseases do happen when mutations occur in
MtDNA D-Loop, especially cancers. But because the DNA in the MtDNA D-Loop is so small (just 500 nucleotide base-pairs in length and no genes)
compared to the whole of MtDNA (16,569 nucleotide base-pairs and 37 genes), diseases caused by mutations in
MtDNA D-Loop are limited in scope. Far more serious mitochondrial diseases occur outside MtDNA D-Loop than inside the D-Loop.
Scientists have discovered that on rare
occasions, severe mitochondrial diseases including some forms of hearing impairments, brain damage,
muscle wasting, and diabetes, have been associated with mutations on MtDNA, (outside the D-Loop). In another example, Professor Douglas C Wallace at Emory University Medical School
in the 1980s discovered that mutations in MtDNA (outside the D-Loop) can cause the
inherited human disease, Leber Hereditary Optic Neuropathy. In other to prevent mitochondrial diseases, in
2015, Britain may be the first to use
techniques to correct mutations in MtDNA for future generations via the Human Fertilisation and
Embryology (Mitochondrial Donation) Regulations 2015.
The 2015 regulation dubbed Three-Parent Babies by mainstream media, has caused much confusion among
members of public who think MtDNA is part of nuclear DNA and the 2015 regulation
simply wants to modify a person's genome, which is of course just unethical.
But this is not the case, since MtDNA is in no way related to nuclear DNA and
so modifying MtDNA does not modify a person's genome. The new technique is being researched
by boffins at the University of Newcastle. Basically it involves removing all the mitochondria or cytoplasm
in a female patient's egg cell (about 100 plus mitochondria exist in a single egg cell, most human
cells may house anywhere from 2 to 2,500 mitochondria, depending on tissue type), and
inserting about 200 plus new mitochondria or cytoplasm from a healthy female donor, (using a technique called ooplasmic transplantation).
Next IVF or (in-vitro fertilisation) is used to fertilise the modified egg cell in a test-tube (containing
both patient's nuclear DNA and donor's MtDNA)
with partner's sperm cells. Another but more easier method is to gently remove the entire nucleus from the female patient's egg cell
and insert it in a donor's egg cell (whose nucleus has already been gently removed) then follow up with IVF.
The mitochondria in sperm cell tails always remains outside the egg cell after fertilisation and the sperm tail self destructs. Ooplasmic transplantation and subsequent IVF are very delicate procedures and time-consuming and
like the birth of the world's first test tube
baby (Louise Brown) born via IVF treatment invented by Dr Robert Edwards in 1978 in Britain, "Three-person babies"
will be another British first and important milestone when the first baby is born via modified
MtDNA.
BREAKING NEWS:
In August 2017 the respected British journal Nature reported that U.S. Professor Juan Carlos Izpisua and Korean-American Dr Jun Wu at the famous Salk
Institute in the U.S. using a gene therapy technique known as CRISPR-Cas9
were able to alter faulty genes in human embryos!!
The faulty genes had a mutation that would have caused several serious genetic diseases in the embryos, had they been naturally fertilized and grew into babies.
This is the first time that gene-editing tools have been used to fix a mutation in cells at the embryo stage. But some experts warn that this is not about designer babies:
safety of the methods used in the ground-breaking experiment need to be established before they are adopted clinically in hospitals and clinics.
CRISPR-Cas9 is works like a type of molecular schissors that can selectively trim away unwanted parts of nuclear DNA sequences
in a genome and replace them with new good stretches of DNA nucleotide sequences. The gene editing tool known as CRISPR-Cas9 was invented in 2013.
Cas9 is the name of the bacterial enzyme used in the tool whose full name is CRISPR Associated protein9.
CRISPR means Clustered Regularly Interspaced Short Palindronic Repeats. How this molecular genetics tool actually works is way beyond the scope of this blog, but you can google the word
"CRISPR-Cas9" for more information.
We will read more about enzymes (i.e. restriction enzymes) that can cut DNA at very specific parts: see the sub-heading
"What Are Restriction Enzymes?"
BREAKING NEWS: In December 2018, the scientific community was shocked to hear that Chinese researchers were able to use gene-editing tools based on CRISPR-Cas9
to alter (or tweak as reported) the genome of an embryo, during in-vitro fertilization and impant it into the donor of the egg leading to
live birth 9 months later. In doing so, Professor He Jiankui had used CRISPR-Cas9 to create
the World's first designer DNA baby
It was clearly a big controversy as modern eugenics or genetic engineering is focused primarily on repairing faulty genes (i.e. mutated genes).
But in this case Professor He Jiankui had "created" a baby resistant to a number of serious diseases such as smallpox and cholera.
The jury is out on whether this achievement crossed the line on ethics standards in genetics.
Unfortunately, compared to mitochondrial DNA, when mutations (e.g. repeats, deletions, substitutions) occur in nuclear DNA, and they do occur every now and then,
far worse things do happen, such as more severe genetic diseases like Down's Syndrome,
which is caused by having an extra copy of chromosome 21, (i.e. repeats of nucleotides in
chromosome 21). If an extra copy occurs on chromosome 23 (the X-chromosome) in a male, it leads to a genetic condition
known as Klinefelter's Syndrome in which a male has a whole extra copy of his X chromosome, such a male
has X-X-Y sex chromosomes instead of the normal X-Y sex chromosomes.
More information at:
http://www.bbc.co.uk/news/health-27341507
How Long Does It Take For a Mutation to Reveal Itself ?
Both Lactose Tolerance and Sickle Cell Anaemia
mutations took at
least 5,000 years for it to
show up in Europe and Africa respectively 5,000 years ago. The FOXP2 mutation in modern humans took just 7 million years to manifest itself.
Some mutations can take months: Certain former drugs like Thalidomide taken by pregnant women to treat nausea
caused mutations to occur in the genes (Sonic Hedgehog genes) that control the correct growth of limbs in a developing embryo. Leading to
the birth of baby with phocomelia (rare condition in which babies are born with limbs that look like
flippers). Hence depending on the mutation, manifestation of a mutation, takes from millions of years to a few months.
Unfortunately there is one type of bad mutation that can occur in hours. In the event of World War 3, a nuclear war
will mean massive doses of nuclear radiation being exposed several hundreds of thousands of individuals in a matter of minutes.
The end result is radiation sickness.
The horrible fallout from nuclear explosions spit out huge amounts of gamma rays; alpha and beta particles and neutrons, all
with enough high energy to rip electrons off atoms or molecules, and that includes DNA molecules!
The altered bonds in DNA produce ion pairs that are extremely chemically reactive.
This is known as ionising radiation and leads to radiation sickness, depending on the dose of exposure, radiation sickness is always fatal. Thus even if one survived a nuclear blast and the huge heat wav generated,
and instant radiation sickness, there is still the fact that mutations in cells have been triggered several hours after the blast from low dose exposure to nuclear radiation.
When radiation deposits enough energy to disrupt molecular bonds,
strands of DNA are broken. While most cells try to repair such damaged DNA properly, around a quarter don't—and so begins a long,
slow process which results in an increased rate of DNA mutations in future generations of cells in a few hours, and the accompaning often fatal aliments.
The 1996 and 2014 Godzilla movies are based on fact:
mutations in animals were caused by radiation emitted from huge nuclear explosion.
How Cracking the Genetic Code and Biotechnology Helped MtDNA Research
Even though Dr Francis Crick and Professor James Watson had worked out
the complex physical structure of nuclear DNA back in the 1950s (which won them the Nobel Prize), there was still a lot of work to be done.
Molecular genetics made huge advances in the early to middle 1960s, when the genetic code was finally cracked by
biochemists Dr Har Gobind Khorana, Dr Robert Holley and Dr Marshall Nirenberg (earning them the
Nobel Prize in 1968 for this). A single protein is made up of hundreds or thousands of amino acids
arranged in a specific order. Likewise a gene is made up of hundreds or thousands of nucleotide base-pairs
also arranged in a specific order or sequence. Since genes code for proteins, what scientists
did not know (before the genetic code was cracked), was how the ribosomes in cells translated
a gene's nucleotide base-pair sequence when it manufactured a protein. Ribosomes
are the parts of a cell whose major job is to make proteins, mitochondria which have their own DNA, do not use ribosomes, they
can make their own specific proteins from within the mitochondria.
Imagine hypothetically if part of the gene sequence for
Insulin was AAA-UAC-GAC-GTT-GTA. How did the ribosomes use the genetic code and place amino acids
in the right sequence to make an Insulin molecule? If just one amino acid was not in
the right order
then the entire Insulin molecule produced will be useless!. These
mistakes do happen, and scientists call these mistakes gene mutations. When a gene is faulty,
due to an error in its nucleotide base-pair sequence, it will code for the wrong protein or a faulty protein.
What Dr Har Gobind Khorana and his colleagues
discovered was that gene expression happens in an orderly nice linear manner. Every Three letters
in a DNA sequence, coded for a specific amino acid based on the Genetic code. For instance AAA codes for the amino acid
lysine and UAC coded for the amino acid Tyrosine. Dr Har Gobind Khorana concluded that the gene for insulin has its entire nucleotide
sequence transcribed into a Messenger RNA or mRNA intermediate code (based on the gene's original DNA nucleotide sequence i.e as a template). mRNA uses an enzyme called
RNA Polymerase which uses DNA as the template to make the mRNA intermediate code.
This mRNA intermediate code as a single strand of mRNA sequences then exits the cell's nucleus where it was originally
produced and enters the cell's cytoplasm where it is promptly
translated by the hundreds of ribosomes into a corresponding amino
acid sequences of the insulin protein molecules. To do this Transfer RNA or tRNA is used to transport amino acids already in the cytoplasm to the ribosomes. The amino acids themselves came from the enzymatic breakdown of meat, fish, chicken and plant proteins like beans we eat. The process of gene transcription in the nucleus (that is process of transcribing RNA, with existing DNA serving as a template) and translation in the cytoplasm is termed Gene Expression.
The above diagram illustrates gene transcription in the nucleus (that is process of transcribing RNA, with existing DNA serving as a template) and
translation in the cytoplasm, in which amino acids are joined together, based on the code from the transcription, into proteins.
In 2006 Dr Roger D. Kornberg received the 2006 Nobel Prize in Chemistry for working out in fine detail the
molecular basis for transcription in human cells, complementing the work of Dr Har Gobind Khorana and his colleagues, who studied the translation part of gene expression.
For discovering the rather complex structure and function of ribosomes
in order to fully explain in fine detail exactly how ribosomes in our cells make proteins using Messenger RNA, amino acids and
Transfer RNA,
Indian biochemist Dr Venkatraman Ramakrishman shared the 2009 Nobel Prize in Chemistry alongside
Israeli biochemist Dr Ada Yonath.
Bear in mind that mRNA enzymes have no control over what is transcribed in the nucleus of cells, so if a gene had the wrong nucleotide sequence (e.g. due to a mutation) then
mRNA enzymes cannot and will not correct this mutation, and thus an incorrect transcribed intermediate code is produced. This incorrect
intermediate code is then translated by the ribosomes into ... yes... a wrong protein (i.e. protein with the wrong amino acid sequence!).
Gene expression is that complicated!
One small mistake (a mutation) in a gene then boom: a big problem is born that will not go away.
While genes mainly code for proteins (enzymes, hormones etc).
many genes do not code for anything at all. Recall earlier on in Section A, I explained that expensive billion dollar Human Genome Project
(completed in 2003), told us that
the human genome has about 70,000 odd genes,
of which about 30,000 genes are protein-coding genes. However the non-coding genes are still important because
many of them control the coding genes, and some are used as replacements for a coding gene that no longer works properly due to mutations in that coding gene
The Unique Mystery Known as Protein Folding
By understanding how gene expression works, i.e.
part of the process by which ribosomes use the genetic code to make proteins like hormones and enzymes (which in turn make other biochemical molecules like sugars etc),
one could easily achieve numerous things such as
creating good artificial hormones like Insulin, instead of extracting them from pigs for human use. However even if
one creates the correct sequence of amino acids in an artificial insulin molecule, it will still be totally unless
scientists can twist and bend the artificial protein in the right way. When any protein is folded in the
right way
it is said to have attained native Conformation and is bioactive: has a positive biochemical effect on living things.
Likewise when a protein is not folded in the right way it loses its conformation and may become inactive or
poisonous or have a harmful effect on living things. This is evident in enzymes made by mutated genes in
Sickle Cell Anaemia.
Mutated enzymes in the red blood cells of Sickle Cell Anaemia are no longer able to produce proper working haemoglobin proteins.
This is because the mutated enzymes has the wrong shape (due to wrong folding). These enzymes
in turn make the wrong type of haemoglobin (with the wrong shape or folding as well) in red blood cells
causing Sickle Cell Anaemia. In a nutshell : Before proteins can do their jobs, they have to be folded in a
proper way, as the shape determines the function of the protein.
All proteins have
unique three-dimensional (3D) shapes, and a protein will not work unless it is meticulously folded in the right way.
Biochemists call the
3D shape of proteins its Tertiary Structure. The biochemistry of
protein folding is much more complex that understanding the biochemistry of amino acid sequences. However knowing the amino acid sequence is important:
Christian Anfinsen and colleagues in the early 1960s
proved that amino acid sequence determines the shape of smaller proteins (called the Anfinsen's Dogma),
a discovery for which Anfinsen received the Nobel Prize for Chemistry in 1972. This makes sense: a protein with lots n lots of amino acids will fold several times
more compared to a protein with far fewer amino acids AND a protein with the wrong sequence of amino acids (e.g. due to mutation in the gene that made it) will fold
in a very DIFFERENT way compared with a protein with the right sequence of amino acids. But Anfisen still did not
tell us how the actual folding is pre-determined in larger proteins! Scientists did discover the power of
Heat Shock Proteins (HSP), which are a group of proteins involved in the folding and unfolding
of other proteins. Among severe health disorders caused by "misfolded proteins" (natural protein folding the wrong way) are Morbus Alzheimer,
cystic fibrosis, and BSE or bovine spongiform encephalopathy (a.k.a Mad Cow disease).
It is thus important that when a protein is artificially made in a lab (as opposed to extracting it from animal or human organs such as insulin protein) for human use:
it is folded in the RIGHT way or Native Way, in order that the protein functions properly in the human body,
since our immune system will attack any protein or polypeptide molecule (smaller proteins) it does not recognise, that is injected into the human body.
While powerful supercomputer simulations are getting close to solving the protein folding and tertiary structure mystery to this day,
by 2016, with all the advances in molecular biology, it is still impossible for the best minds in biochemistry or protein science
to 100% predict from the amino acid sequence, how the corresponding protein will fold (large proteins with thousands of amino acids).
Many proteins are able to fold themselves quickly and properly into a complicated conformation
without any help of a cellular “folding apparatus”. How they achieve this is still a mystery.
A polypeptide chain could spend more time than the age of the universe “trying” all of its possible conformers or Levinthal's Paradox
to find its native one. But in reality, natural protein folding magic never takes more than a few seconds, for instance
scientists calculate that several large human proteins fold as fast as a millionth of a second! that's in the fraction of a blink of an eye. Now lets do the math:
modern computers can take a day to simulate about 50 nanoseconds (50/1,000,000,000 of a second).
Unfortunately, many proteins fold on the millisecond timescale (1,000,000 nanoseconds).
Thus, it would take 20,000 days to simulate complex protein folding by a computer — i.e. it would take 60 years!
That’s a long time to wait for one result!
From 1998, protein scientists have set up platforms such as Rosetta and Rosetta Commons, where teams of top protein
scientists around the U.S. build virtual chains of amino acids, then
using complex computer software, they worked together to find out the most likely shape and form the joined amino acids would fold into. Scientists already knew that proteins fold because
each amino acid in the protein chain has an electric charge. Recall earlier on in Section C, I explained how hydrophobic bonding permits the assembly of
important biological molecules in our cells such as ribosomes building up proteins from amino acids as well as eventual protein folding. Hydrophobic bonding
in the context of protein folding is based on certain molecules like amino acid alanine, hating water so much! Thus parts of the protein chain are attracted to one
another (forming a bond!!), while other parts of
a protein chain are repelled. The end result of all this is
eventual unique folding shape of a particular protein: depending on the different types of attracting and repelling amino acids in its chain. When any
protein is folded in the
right way
it is said to have attained native Conformation and is bioactive. Scientists working on created hundreds of new proteins that had all attained native Conformations!!
The human body makes
roughly 20,000 different proteins such as collage, haemoglobin, enzymes, hormones etc.
Each of these 20,000 proteins have unique shapes due to the amino acids arrangement. That is 20,000 proteins with 20,000 unique native Conformations.
GOOD NEWS......
Scientists CAN however
predict how the smaller proteins (e.g a few hundreds of amino acids) will fold, after discovering that hydrophobic interactions
between non-polar amino acid residues are sufficient to fold a polypeptide chain into its native shape in a reasonable time.
But this works only if the protein chain is not longer than 200 amino acids!
MORE GOOD NEWS......
In 2011 boffins at the
Oak Ridge National Laboratory in the U.S. led by Dr Pratul Agarwal, a computational biophysicist, using high tech computers and advanced mathematics,
announced a "possible" invention, based on quasi-anharmonic analysis or QAA, that is able to quickly predict three-dimensional structure of larger proteins. It's too complex to decribe
what the invention is but the curious can check out the source below. Warning, you need to know basic differential calculus, and Kinetics on top of advanced biochemistry
to understand the paper!
Source: Arvind Ramanathan, Andrej J. Savol, Christopher J. Langmead, Pratul K. Agarwal, Chakra S. Chennubhotla.
Discovering Conformational Sub-States Relevant to Protein Function.
PLoS ONE, 2011; 6 (1): e15827 DOI: 10.1371/journal.pone.0015827
Direct link to the research paper
In 2013, IBM was granted a patent:
U.S. Patent #8,423,339: Visual Analysis of a Protein Folding Process. It was issued in April 16 2013 to its inventors: Laxmi Parida and Ruhong Zhou, who worked at the
IBM Computational Genomics Group.
Direct link USPTO database and the patent
In summer of 2017, several scientists in the U.S. have claimed to have finally solved
the mystery of folding in large complex proteins. In one example, Dr David Baker of the Institute For Protein Design at the University of Washington published
research papers on how complex protein folding works. His research (based around his Rosetta@home program) is very
promising as it has useful applications in other fields such as helping in cancer research,
much more research work needs to be done however to prefect the techniques.
Biotechnology companies like Genentech, Amgen and
Biogen Idec have now produced dozens of small human proteins (enzymes, hormones, co-enzymes, etc) artificially for human use and in each case managed to fold the protein in the right way 100%. When the artificially made proteins such as EPO or Epogen are injected into humans for use, our immune system recognises the protein as OK (protein is the right sequence AND it is folded in the right way!) and so does not attack the artificial protein. Made by Amgen, Epogen (Epoetin alfa)
is most successful biotechnology drug in history. Epogen, used for treating kidney disorders, and blood disorders such as anaemia, is the name of the artificially-made version of the naturally occurring protein,
Erythropoietin (a glycoprotein hormone that controls erythropoiesis, or red blood cell production in bone marrow). Erythropoietin is made naturally in our kidneys, and as a hormone, Erythropoietin instructs your bone marrow to make red blood cells at the right levels on a daily basis. In kidney disorders, and blood disorders such as anaemia, the kidneys do not manage Erythropoietin production at normal levels, so red blood cell levels are too low and problems begin. It was very difficult to extract natural Erythropoietin from animal sources for human use and so biotechnology and Amgen came to the rescue! In sports events such as athletics, EPO can be used to boost stamina and endurance a great deal, by enhancing VO2max via
boosting blood EPO levels (your ability to intake oxygen is maximised), hence is banned in professional sports, using EPO in athletics is a form cheating.
Once the genetic code was cracked, a huge spike of successful applied DNA research work,
covering things like genetic engineering / biotechnology
in the early 1970s, was made by DNA scientists and molecular biologists in the U.S. such as Drs Max Delburck, Walter Gilbert, Paul Berg, Stanley Cohen and Herbet Boyer etc and
biochemists such as Britain's Dr Fred Sanger. This in many ways served as a sound platform to apply these many new technologies in studying human evolution at
a molecular level using MtDNA from the 1980s.
How do Geneticists Isolate MtDNA from Cells?
Today, there are about half a dozen
major manual ways
of extracting MtDNA from cells in labs worldwide. The number one concern is usually contamination from genomic (nuclear) DNA.
Step 1. If blood is used for extracting MtDNA, then only the white blood cells are required, because red blood cells
do not contain any mitochondria so no MtDNA! (also red blood cells have no nucleus so no nuclear DNA). So during MtDNA extraction using blood,
both plasma (liquid part of blood) and red blood cells must be removed. To remove red blood cells,
test-tube with blood is put into a centrifuge which spins at great speeds, separating the red cells
from the rest of the blood (e.g the liquid part and white blood cells). But some may still remain.
Step 2. Red blood cells can be further removed with strong hypotonic EDTA solution.
The hypotonic solution causes the red blood cells to split open, but leaves white blood cells intact
(white and red blood cells have different strengths of membranes).
Biochemists have long known that chemicals can be used to exploit the different types of cell membrane strengths, composition and types in different
cells (human, bacteria and fungi etc).
For instance, anti-fungal
creams can easily split open and destroy fungus cells on human feet that cause athlete's foot,
but leave all other human cells in the feet intact. Meanwhile antibiotics used to tackle tuberculosis split open and destroy tuberculosis
bacterial cell membranes but leave all nearby human lung cells intact.
Step 3. Now only white blood cells are the only cells in the test tube plus plasma.
But debris from lysed red blood
cells, (e.g. haemoglobin) are also present as well, we need to remove all these. So we again put test-tube in a centrifuge for more spins.
White blood cells are separated from red blood cell debris and plasma, after several doses of centrifugation, forming a "pellet" in the bottom of the
centrifuge tube. The supernatant (that is liquid above the reside at the bottom of the test-tube), containing haemoglobin,
plasma proteins, and other soluble components from the lysed red cells
and finally the plasma is poured off leaving a relatively clean white blood cellss pellet at the bottom.
During this process, a resin is added to absorb (and thus help us remove) the iron (from haemoglobin) which has been leached out from the red
blood cells. With the red blood cells out of the way, we now turn our attention to the
white blood cells.
Step 4. All the remaining white blood cells in the test-tube have to be split open (i.e. lysed): lysis detergents are used
to break open all the white blood cells membranes, (it can also be used to break open other types of cells such as bone, sperm or skin cells), spilling the contents of the white blood cells
into the test-tube.
Typical lysis detergents used for lysis are Sodium Dodecyl Sulfate (SDS or NaDS) or
Sodium Lauryl Sulfate (SLS). SDS, also known as Duponol is the popular choice for biochemists
extracting MtDNA.
Step 5. Next genomic (nuclear) DNA in the test-tube must be
removed using special enzymes or DNAse, which are enzymes that only target (breaks down) genomic or nuclear DNA, leaving MtDNA unharmed, afterwards other types enzymes are used to
break down all the proteins (using such as Proteinases enzymes which destroys proteins); RNA (using RNase enzymes which destroys RNA); sugars and
fats; in the test-tube. Once this is done, lot of debris now has to be removed to obtain pure concentrated MtDNA!! To do this we add concentrated salt solution to the test-tube, this causes the partially broken up proteins (alongside peptides) and other cellular debris to clump together.
N.B. If we were extracting nuclear DNA and not MtDNA, say in forensic science police investigations, we would also need to use a special enzyme known as
Proteinase K . This is because nuclear DNA is still wrapped very tightly
around specialised proteins called histones which protect and stabilise nuclear DNA from damage when not in use.
Proteinase K cuts away the histones, liberating nuclear DNA. And of course no DNAse enzymes are used since we are after nuclear DNA.
Interestingly mitochondria do not have histones, so no proteins are bound directly to MtDNA!
Once the concentrated salt solution has done its job, we probably want to ensure that the peptides
and other cellular debris have clumped together completely and properly, so we again put test-tube in a centrifuge for more long spins.
If everything goes according to plan, the clumps of peptides and other cellular debris sink to the bottom of the test-tube. Next pour out the liquid (minus the clumps of peptides and other cellular debris) into a fresh new test-tube.
Rubbing alcohol (i.e isopropyl alcohol) is often used in the final stages of MtDNA extraction as
under the right conditions MtDNA will not dissolve in isopropyl alcohol, but other minute debris of the cells in the test-tube (that did not forms clumps) will dissolve, so allowing
the separation of MtDNA in pure form, with less than 0.5% contamination!
Isolated MtDNA now appears as white cotton strands on the sides of the test-tube after isopropyl alcohol treatment. Mission Accomplished finally. Job done!!!!
If extracting MtDNA from other types of cells like those found in saliva, cheeks, skin, semen (sperm cells), bone, hair cells or tissue,
we start from step 4.
One faster popular method of extracting MtDNA is Abcam's Mitochondrial DNA Isolation Kit.
It provides convenient
tools for isolating MtDNA from a variety of cells and tissues in high yield and purity,
without contaminations from genomic (nuclear) DNA. Once minute amounts of pure MtDNA is extracted, it has to be amplified.
DNA Sequencing and Identification (DNA Analysis)
To analyse minute samples of purified MtDNA, following painstaking extraction, one
first needs to amplify the tiny amounts of pure DNA extracted, into
sufficient quantities for analysis. To do this biochemists use
PCR or Polymerase Chain Reaction. This wonderful and exciting technology is used a billion times all over the world in labs today. Put simply PCR
multiplies tiny amounts of the same copies of DNA thousands upon thousands of times:
from minute picograms or nanograms of DNA to micrograms or even milligrams or grams of DNA!
The extremely useful PCR was invented in the 1983 by
U.S. biochemist, Dr Kary Mullis who won the 1993 Nobel Prize for Chemistry just for inventing this technology.
Next up is to cut the amplified DNA at specific points using specialized enzymes.
What Are Restriction Enzymes
Restriction endonucleases (Restriction Enzymes) are types of enzymes that can cut DNA at or near
specific recognition nucleotide sequences known as restriction sites.
In order to study (analyse) MtDNA at particular points, biochemists need to use specialised
enzymes that can cut MtDNA at very precise spots.
When biochemists want to study DNA, they already know which parts of the long DNA strands they want to study, So before any analysis takes place, they want to
cut the DNA at certain points.
For this biochemists
need to use special enzymes called Restriction Enzymes.
As an example,
when biochemists
want to study MtDNA for ancestry research and population genetics, they may only need to study the tiny D-Loop (or Control Region) portion of MtDNA, not all of it.
To do this they need to use restriction enzymes that allow them to cut away the MtDNA, at the D-Loop
portions from the rest of the MtDNA. Recall that I explained that most mutations occur in the
D-Loop of MtDNA. Restriction enzymes are thus extremely useful tools and the American
discoverers were deemed worthy of a Nobel Prize: in 1978, Drs Werner Arber, Daniel Nathans and Hamilton, O. Smith
were awarded the Nobel Prize in Medicine
for discovering restriction enzymes. Next up is DNA sequencing. Sometimes in research projects, biochemists sequence DNA before cutting it.
Automated and Manual DNA Sequencing
Once DNA has been amplified and cut, we now turn to sequencing.
What on Earth is DNA Sequencing?
DNA sequencing is the biochemical process of determining the order of nucleotides within a strand of DNA, that is
determine the order of the four nucleotide bases—adenine, guanine, cytosine, and thymine—in a strand of DNA.
An example of a sequenced of portion of a MtDNA strand is
CCAATTTATTCGAAACCCCAATTATTCGAACCCCAATTTATTAACCTCGAAACCCCAATTATTCGAACCCCAATTTATTAACC This DNA sequence is less than 80 nucleotide base-pairs
in length, so can be sequenced in under an hour. Imagine accurately sequencing DNA that is over 3 billion nucleotide base-pairs in length!! Well that is what the expensive Human Genome
Project achieved back in 2003. In the process scientists who worked on the project, identified over 30,000 human genes located on the sequenced DNA. It was not an
easy task as the Human Genome Project took over 10 years to complete!! Final cost: $2.7 billion.
There are two ways of sequencing DNA:
automated and manual methods. Automated sequencing involves using rather expensive computerized DNA sequencers, such as those manufactured by Applied Biosystems,
Roche, Illumina, Pacific BioSystems etc.
Sometimes when budget is tight and automated sequencers are out of the question,
it is still possible to manually sequence DNA using several methods. One popular method was
developed British biochemist Dr Fred Sanger (more details
of Fred Sanger's contributions to sequencing is given below).
The results in most manual methods of DNA sequencing is slow and show up on a polyacrylamide gel.
This method can take from a few hours to a few days in some cases.
Dr Fred Sanger and DNA Sequencing
The DNA sequencing method developed by British biochemist Dr Fred Sanger
forms the basis of automated "cycle" sequencing reactions today.
Scaling up to sequence. In the 1980s, two key developments allowed researchers
to believe that sequencing the entire genome could be possible.
The first was a technique called Polymerase Chain Reaction or PCR, already discussed previously.
PCR enabled thousands of
copies of minute DNA to be quickly and accurately produced and grown (amplified) into
huge amounts of DNA sufficient for analysis. PCR was invented in the 1983 by
U.S. biochemist, Dr Kary Mullis.
The second key development, an automated method of DNA sequencing, built upon the chemistry of PCR
and the sequencing process developed independently by British biochemist Dr Frederick Sanger and American biochemist Dr Walter Gilbert, who both
shared the 1980 Nobel Prize for DNA sequencing.
Dr Fred Sanger's group at Cambridge University MRC Labs in Britain, produced the easiest DNA sequencing methods, still used today. Among Dr Sangers firsts were:
first DNA whole genome sequence (for a virus called phiX174 that grows in bacteria)
of just over 5000 base-pairs. First human genome sequence, albeit that of the DNA in mitochondria, and first genome sequence
of an important virus for molecular biology, the
bacteriophage lambda in 1982. Bacteriophages are type of viruses that only attacks bacteria.
To sequence this virus genome (about 48,000 nucleotide base-pairs)
Dr Fred Sanger developed the Whole-Genome Shotgun. The sequence of lambda virus
DNA was thus the first
Whole-Genome Shotgun Sequencing. Today Whole-Genome Shotgun Sequencing is one of the fastest and least expensive ways of sequencing DNA.
Sanger who also discovered the correct amino acid sequence of the Insulin hormone, is the only
person to this date, to have won the Nobel Prize for Chemistry twice (for his work on DNA and protein sequencing).
Identifying and Comparing DNA Sequences
Sequencing DNA and identifying DNA often go hand in hand, but strictly speaking
to specifically identifying specific sequences of MtDNA such as finding polymorphisms (SNPs) in MtDNA, several additional methods exist.
In the 1990s Dr Peter Oefner and Dr Peter Underhill at Stanford University developed
one of the most popular methods of
identifying the sequences of DNA using HPLC or High Pressure Liquid Chromatography. Their method is today
known as Denaturing HPLC or dHPLC. Their method is based on a very simple rule in biochemistry: You recall that I mentioned that
DNA is double-stranded and in the DNA base-pair nucleotide structure Adenine always pairs with Thymine and Guanine always
pairs with Cytosine: this means if you know the sequence of DNA nucleotides in one strand, you can figure out
the sequences of DNA nucleotides in the other strand.
Another procedure known as Southern Blotting is particularly very accurate.
Southern Blotting which was invented by
British biochemist Dr Edwin M Southern, involves using
fragments of DNA that separate
on a gel and transferred directly to a second medium on which assay by hybridisation is carried out, following this one can easily identify
DNA sequences.
Lets assume biochemists have identified two DNA sequences, say one is human DNA and the other is chimp DNA. Several methods exist for comparing DNA sequences. One way is via a method known as DNA Hybridization. Here the double strands of the DNA from both chimp and human are made to separate by heating them. When they cool down they will re-form double helices wherever sequence identity is high and matches can be made. Where chimp DNA fuses with human DNA, hybrid DNA is formed. The degree of hybrid match is estimated by its thermal stability compared to the separate DNA of each species.
Computerised (Automated) DNA Sequencers can sequence and identify DNA much faster than manual sequencing method that reveal results on a gel,
but they are very expensive to purchase for most research labs on a very limited budget.
Diagram above shows one of the popular methods of manually sequencing DNA (used a lot in forensic labs in police stations worldwide for DNA profiling), invented by Dr Fred Sanger of Britain. Results show up on a gel. This method can take hours, even a few days in some cases, automated sequencers are faster but expensive. The results from automated sequencers are also faster to read.
The first and best method of sequencing (analysing) DNA was devised independently by Dr Fred Sanger and Dr Walter Gilbert. Typically to sequence the DNA,
it must first be separated into strands.
The strand to be sequenced is copied using chemically altered bases.
These altered bases cause the copying process to stop each time one particular letter is
incorporated into the growing DNA chain. This process is carried out for all four bases,
and then the fragments are put together like a jigsaw to reveal the sequence of the original piece of DNA.
Fred Sanger and his colleagues developed many of the DNA sequencing techniques still used in molecular genetics
to this day. The fundamental method of 'reading' DNA using special bases called chain terminators (Sanger' method is also called The Chain Termination Method); the use of very thin gel systems; electrophoresis to separate DNA fragments on a polyacrylamide gel;
the adaptation of efficient cloning methods to produce both
DNA strands and the whole-genome shotgun described above (a very fast way of sequencing DNA)
were all developed by Fred Sanger and his group in Britain during the 1970s.
NEW UPDATED DATA
The above diagram shows how the results of
manual DNA sequencing looks like on a polyacrylamide gel (or Agar) gel. Basically before the electric current is applied, the gel is placed horizontally, and as an electric current is applied, electrophoresis causes the DNA sample to suddenly separate into several distinct bands (in purple colour): due to gravity, the heavy bands stay near the top of the gel, and the lighter bands stay near the middle and bottom areas. These bands are the genetic fingerprint of that particular sample. Different DNA samples will ALWAYS have different DNA band patterns, so no two DNA samples have the same band pattern except from say twins. By comparing these bands with those of a control marker DNA (one that is already sequenced and banded), one can easily tell if there is a DNA match between the DNA sample and the control sample! If these is no DNA match, the DNA is stored on specialised DNA databases, to be called up for comparison again in the future.
N.B. UV-transilluminators have to be used to view DNA (or RNA) that has been separated by electrophoresis through an agarose or polyacrylamide gel. During or immediately after electrophoresis, the agarose gel is stained with a fluorescent dye ( such as ethidium bromide) which binds to nucleic acids in the DNA or RNA. Exposing the stained gel to a Ultraviolet light source causes the DNA/dye to fluoresce and become visible for comparison.
The above diagram shows how
the DNA sequencing results show up on the Automated DNA Sequencer's computer screen
as a chromatograph.
While the results of manually sequencing MtDNA show up on a polyacrylamide gel. Automated DNA Sequencers
show the results on a computer screen as a nice coloured chromatograph. It is easy to read a chromatograph in minutes, than spend an hour or so reading results from a gel. Today extracting and sequencing MtDNA is so advanced than
in December 2013, scientists led by Professor Svante Pääbo at the Max Planck Institute for
Evolutionary Anthropology in Leipzig, Germany announced that they had extracted and
sequenced the oldest ancient human MtDNA from a fossil dating back to 400,000 years ago!.
The previous world record for oldest sequenced DNA, had been MtDNA belonging to a
Neanderthal fossil dating 100,000 years ago (set by French and Belgian scientists in 2006).
Did You Know That?
As I previously explained earlier on above,
Mitochondrial DNA extraction, isolation and sequencing, normally takes from a couple of hours up to 2 or more days for standard
DNA profiles to be made in a police labs, research labs etc.
The American company IntegenX changed all that with the
introduction of the world's first portable DNA profiling machine, named the RapidHIT 200.
This machine the size and weight of a medium sized home printer, which
can be operated by non-scientists, is given DNA samples put in a
special rectangular plastic cartridges, and in under
2 hours it can analyse the DNA for SNPs (Single Nucleotide Polymorphisms) and STRs (Short Tandem Repeats) via automated DNA extraction, PCR and other molecular genetics technologies such as Promega's PowerPlex® 16 SystemHS. Incidentally
Promega is one of two main suppliers of systems for genetic identification based on
DNA analysis of short tandem repeats. Promega was the first company to provide specific enzyme kits
that make STR and SNP analysis of single loci possible, for machines like RapidHIT 200 to use for the DNA analysis part . The other main supplier of enzyme kits is Applied Biosystems. Once RapidHIT 200 has
finished the DNA analysis for STRs and SNPs
it instantly builds up an accurate DNA profile based on the SNPs and STRs it finds! That's not all, it can print out the DNA profile on a photographic glossy paper or use
specialised software built into the RapidHIT 200 to digitally connect to a host of DNA database servers via the Internet or local network (intranet) a
nd look for a match!! All this in under 2 hours. Microsatellites or Short Tandem Repeats are discussed later on in this ebook.
The difference between computerized DNA sequencers used in biomedical and genetics research labs (such as those manufactured by Applied Biosystems,
Roche, Illumina, Pacific BioSystems etc) and the IntegenX RapidHIT 200 is that while computerized DNA sequencers are expensive, huge (thus not easy to carry around) and
complicated to operate, RapidHIT 200 is not as expensive, it is small and thus very portable to carry around and can be operated by
anyone without any technical knowledge! However for obvious reasons computerized DNA sequencers provide
much more detailed data and can be configure or easily upgraded to carry out brand new tasks. The FBI and other law enforcement agencies around the world,
have all approved RapidHIT 200 for use in their forensic labs and placed orders.
the RapidHIT 200 machine
Major DNA Sequencing Databases And Other Biological Databases Around the World
Now that we have a basic understanding of how DNA is extracted and sequenced, lets now take alook at several important DNA databases around the world, that
biochemists, geneticists, anthropologists, medical scientists, academics and others use for research work, genetics surveys, statistical analysis and in commerce etc.
The National Centre of Biotechnology Information (or NCBI) in the U.S. (part of the National Library of Medicine, itself a
department of the National Institutes of Health in Bethesda, Maryland) has over 5,000 completely sequenced human mitochondrial genomes from different ethnicities
and now available for study at the huge Entrez Nucleotide Database (website is http://www.ncbi.nlm.nih.gov/sites/gquery).
The British Cambridge Reference Sequence or CRS database is a huge important repository of sequenced genomes such as the H haplogroup (we will discuss more on human haplogroups
later in this section).
In France there a very huge database of
sequenced nuclear DNA, available for researchers at the Paris-based Centre for the Study
of Human Polymorphisms. In French this institute is better known as Foundation Jean Dausset-CEPH or CEPH (for French: Centre d'Etude du Polymorphisme Humain).
It was founded in 1984 by the famous French biochemist
Jean-Baptiste-Gabriel-Joachim Dausset.
Website: http://www.cephb.fr
The 1000 Genomes Project ran between 2008 and 2015, creating the largest public catalogue of
human variation and genotype data. As the project ended, the Data Coordination Centre at EMBL-EBI
has received continued funding from the Wellcome Trust to maintain and expand the resource.
Briefly, the 1000 Genomes Project, which began in 2008 and involved scientists
from universities and research institutes worldwide, built on data compiled by the
earlier International HapMap Project (see below), which generated a haplotype map of the
human genome to facilitate the discovery of genetic variants associated with diseases and disorders.
(Recall that alleles are alternative versions of a gene and a haplotype is a set of alleles, or differing forms of genes, that occur close to one another
on a chromosome and tend to be inherited together.) The 1000 Genomes Project consisted of two main phases: a pilot phase, completed in 2010, and a
phase involving full-scale genome studies, scheduled for completion in 2015. The pilot phase was
further divided into three projects that were designed to develop and compare different
high-throughput, genome-wide sequencing strategies that could expedite the later full-scale studies.
Two of the three projects relied on newly developed technologies capable of deep-coverage sequencing,
in which DNA segments were read rapidly multiple times to ensure that the determined order of bases
was accurate. The two projects based on deep coverage, which enhanced the ability to detect low-frequency
mutations, involved genome sequencing of a small number of trios (a trio being two parents and one of
their offspring) and the sequencing of exomes (genomic regions containing protein-coding genes) of 697 individuals. The third project involved
low-coverage sequencing of the genomes of 179 individuals from China, Europe, Japan, and West Africa. The full-scale study phase entailed analysis of
samples from 2,500 individuals representing different populations worldwide and made use of a combination of low-coverage whole-genome sequencing, deep-coverage
exome sequencing, and array-based SNP genotyping. The data compiled by the 1000 Genomes Project was made freely available to the public and research community
on various platforms, including through the project Web site and through Amazon Web Services, a cloud-computing system hosted by online retailer Amazon.com
International HapMap Project
is an international collaboration aimed at the identification of
genetic variations contributing to human disease through the development of
a haplotype (haploid genotype) map of the human genome.
A haplotype being a set of alleles (differing forms of genes) that occur close
together on a single chromosome and tend to be inherited together.
By identifying haplotypes and mapping their chromosomal locations,
scientists are able to associate genetic variants with specific diseases and disorders.
The International HapMap Project originated in October 2002, supported by private and
public funding, with participating scientists located in Canada, China, Japan, Nigeria,
the United Kingdom, and the United States. The HapMap effort was an outgrowth of the
$2.7 billion Human Genome Project (HGP), which was completed in 2003.
In addition to making use of the genome sequence data published by the HGP,
HapMap researchers utilised the Database of Single Nucleotide Polymorphisms or (dbSNP)
maintained by the National Center for Biotechnology Information.
The dbSNP database contains information on millions of genetic variations in
single nucleotides in DNA (recall that the four DNA nucleotides are adenine [A], guanine [G], thymine [T],
and cytosine [C]). An example of such a variation is the presence at a
given polymorphic site on a chromosome of a T in some persons versus an A
in others. SNPs occur regularly and frequently throughout the human genome,
with approximately 1 in every 300 bases, or an estimated total of
10 million within the 3 billion nucleotides of the human genome.
The Encyclopedia of DNA Elements or ENCODE is a public research database launched by the US National Human Genome Research Institute (NHGRI)
in September 2003. Intended as a follow-up to the Human Genome Project, the ENCODE project aims to identify
all functional elements in the human genome.
OMIM (http://www.ncbi.nlm.nih.gov/omim). The U.S. based Online Mendelian Inheritance in Man database is the most reliable single source of information on human Mendelian characters and the underlying genes. The index numbers (e,g. OMIM 193500) give direct access to the relevant entry in the database. OMIM contains about 20,000 entries, which may be sequenced genes or diseases associated with known sequenced genes, or characters that are inherited in a Mendelian way but for which no gene has yet been identified.S Some entries describe characters that are not normally Mendelian. In those cases the OMIM entry will concentrate on any Mendelian or near-Mendelian subset and may therefore not give a balanced picture of the overall etiology. Each entry is a detailed historically ordered review of the genetics of the character, with subsidiary clinical and other information, and a very useful list of references.
GeneTests (http://www.genecl inics.org) is a database of human genetic (Mendelian) diseases, maintained by the US National Institutes of Health and aimed mainly at clinicians. It includes brief clinical and genetic reviews of about 1000 of the most common Mendelian diseases. There is more clinical information than in OMIM.
Many major genetics databases worldwide are in the hands of international consortia. For example, an advisory
committee made up of members of the European Molecular Biology Laboratory Nucleotide Sequence
Database (EMBL-Bank) in the Britain (Cambridge) and Germany (European Bioinformatics Institute, Heidelberg), the DNA Data Bank of Japan in Tokyo (DDBJ), and
GenBank of the National Center for Biotechnology Information in the U.S.
oversees the International Nucleotide Sequence Database Collaboration (INSDC). GenBank itself is
large
database of DNA sequences (from 100,000 living species) submitted to it from genetics
laboratories around the world. By 2015 more than 300 billion DNA sequences had been submitted.
Access to the database is made free for researchers.
The EMBL databases
include ArrayExpress, European Nucleotide Archive or ENA, Ensembl (see below), Expression Atlas and InterPro (a protein database).
The Ensembl database (website is http://www.ensembl.org/index.html), run by the EMBL and the Wellcome Trust Sanger Institute, is a huge genome database of animals, plants and humans and popular for human ancestry studies due to its
huge collection of Single Nucleotide Polymorphisms (SNPs) in human ethnic groups. It is the largest of its kind in the world.
As already noted, it is estimated that humans have about 10 millions SNPs (across the total population of humans;
however no single human has all the SNPs).
Thus all over the world, right after the massive billion dollar Human Genome Project of HGP
was completed in 2003, scientists have sequenced thousands upon thousands of both MtDNA and nuclear DNA from different ethnicities and
made this available for other scientists to use for research. This saves so much time and money
from doing the painstaking task of several man-hours of MtDNA extraction and sequencing.
However only in forensic science in police stations, ancestry (genealogy)
tests or court-ordered paternity / maternity cases,
is it absolutely necessary to extract and sequence FRESH new nuclear DNA or MtDNA for identification purposes. E.g. via
(genetic finger printing) for nuclear DNA identification invented in 1994 by British molecular geneticist
Dr Alec Jeffreys. Today short repetitive nucleotide segments in nuclear DNA (known as Microsatellites
or Short Tandem Repeats) are used for the
identification purposes. Microsatellites are discussed later on in this ebook.
Many of these above genetics databases collect DNA, RNA and amino acid sequences from scientific papers and
genome projects.
To ensure that
DNA sequence data are freely available, scientific journals require that new DNA sequences
be deposited in a publicly accessible database as a condition for publication
of an article. The huge free bibliographic database on journal articles known as
PubMed Central database (part of the U.S. National Library of Medicine Medline database)
is the number one place to go when searching for articles about current genetics projects in major journals worldwide (http://www.pubmedcentral.nih.gov).
Research into ways of improving DNA, RNA and protein database construction, use and management
form the basis for the
exciting discipline known as Bioinformatics that fuses genetics and biochemistry data
with computer technology.
Complex search algorithms e.g. BLAST and data formating methods such as FASTA are among the
key areas of improvement in bioinformatics.
Information retrieval from the data archives utilizes
standard tools for identification of data items by keyword; for instance,
one can type “human myoglobin” into Google and retrieve the molecule's
amino acid sequence. Other algorithms search data banks to detect similarities
between data items. For example, a standard problem is to probe a sequence
database with a gene or protein sequence of interest in order to detect entities with similar sequences.
The development of efficient algorithms for measuring sequence similarity is an important goal
of bioinformatics. The Needleman-Wunsch algorithm, which is based on dynamic
programming, guarantees finding the optimal alignment of pairs of sequences.
This algorithm essentially divides a large problem (the full sequence) into a series of
smaller problems (short sequence segments) and uses the solutions of the smaller problems
to construct a solution to the large problem. Similarities in sequences are scored in a
matrix, and the algorithm allows for the detection of gaps in sequence alignment.
Although the Needleman-Wunsch algorithm is effective,
it is too slow for probing a large sequence database.
Therefore, much attention has been given to finding fast information-retrieval algorithms
that can deal with the vast amounts of data in the archives. An example of an
algorithms used in bioinformatics has already been noted above:
BLAST which stands for Basic Local Alignment Search Tool. A development of BLAST, known
as position-specific iterated- (or PSI-) BLAST, makes use of patterns of conservation
in related sequences and combines the high speed of BLAST with very high sensitivity to
find related sequences.
Once I finished my BSc Biochemistry first degree and my MSc masters degree in information science, I did begin a
PhD in Bioinformatics at Oxford University back in the summer of 2000,
but a publishing deal for a book project in 2001,
put paid to me finishing my PhD in Bioinformatics.
The Link Between Mutations and Ancestry
The more mutations (or genetic diversities) in the MtDNA in a person, then the older that person's ancestry. This also means that if MtDNA of an ancient pre-historic person living in France was discovered to the be identical to the MtDNA of a modern person living in France, then this means the ancient person dates back no more than 15,000 years ago.
It will be revealed later on in this ebook that the San people of the Kalahari
Desert in Africa have the oldest ancestry in the world, because they have the most mutations in
their MtDNA. Meanwhile other scientists such as Professor MF Hammer (University of Arizona),
Dr Peter A. Underhill (Stanford University) and
Professor Spencer Wells
(Cornell University),
working with the other main type of genetic markers, the Y-Chromosome DNA, concluded that
the San people of the Kalahari
Desert in Africa have the oldest ancestry in the world, due to the higher number of mutations
found in their Y-Chromosome DNA.
Since then other geneticists around the world have replicated the Wilson, Cann and Stoneking MtDNA research work several types, confirming their discovery and
also producing more detailed genetic maps of human evolution, such as the genetic map used in this ebook above,
which was produced by Professor Emeritus Luigi Luca Cavalli-Sforza (Stanford University) for his 2001 ground breaking
book
Genes, Peoples and Languages
In 1965, when the use of DNA to trace human ancestry was at its infancy, Professor Emeritus Luigi Luca Cavalli-Sforza, a geneticist and his colleagues had used classical
genetical data such as human proteins and blood groups in attempt
to use genetical data on human ancestry research.
In this case analyses of polymorphisms (i.e. markers or mutations) in proteins and blood groups was carried out.
This was before the use of molecular genetical data
(i.e. MtDNA and the Y-Chromosome data)
was widespread from the middle 1970s and early 1980s.
Before I ended Section D, I explained that once ancient humans arrived Bab al-Mandab or Bab al-Mandeb Strait, what happened next, was best explained with a genetics.
Now that I have covered the basics of mutation in our DNA and how mutations (or variations) in Mitochondrial DNA and Y-Chromosome DNA are used in human evolution and migration out of Africa, lets now continue the story about happened at the Bab al-Mandab Strait using molecular genetics alongside evolutionary anthroplogy.
From the expanded genetic map shown below, all non-African
humans (Europeans and Asians) throughout the world today are descended from one
group of Homo sapiens who left Africa (via the Bab al-Mandab Strait) between circa 70,000
to 51,000 years ago carrying human
MtDNA haplogroup lineage L3. L in layman terms is called a genetic marker.
L3 originated from people living exclusively in East Africa near the eastern part of modern day
Djibouti and Eritrea especially near the coastal areas close to the Red Sea shores of these countries.
The most fascinating thing about this location is that it is not far away from the Hadar Region of Ethiopia, where Lucy was discovered in 1974. All this points to a crucial fact:
Kenya, Tanzania and Ethiopia, share the
title as the cradle of mankind, due to the sheer number of overall important human fossils found in these three countries discussed earlier on in this ebook,
mainly along the African Great Rift Valley sites: Olduvai Gorge, Laetoli, Middle Awash, East and West Turkana, Omo, and the Hadar Region. Meanwhile Ethiopia shares the distinction as being not far from Bab al-Mandab, where modern humans last went out of Africa 70,000 years ago.
What Exactly is a Haplogroup?
Earlier on in this ebook, I mentioned phylogenetic trees and I mentioned that the first
phylogenetic tree was created by Cann, Wilson and Stoneking.
Different branches of the phylogenetic tree
can be considered as denoting haplogroups. So the phylogenetic tree created by Cann, Wilson and Stoneking denotes the L haplogroup.
All human MtDNA today now show an average of about 50
mutations which have occurred in the 200,000 years
since Mitochondrial Eve. Some scientists say that in total it is 120 mutations.
Thus the maximum number of MtDNA differences between all humans is 50 (or 120 as other scientists say).
Put in another way, during those 200,000 years modern humans
have gradually but steadily accumulated a maximum of 50 variations in their MtDNA.
The oldest humans (the San natives of South Africa's Kalahari Desert and the Mbo of Cameroon) have the most (up to 120, so have the most genetic diversity),
and all other human ethnic groups around the world have far fewer.
Humanity's 50 variations have been divided into 36 subunits known as haplogroups.
Therefore haplogroups are a group of people around the world who share a set of specific genetic markers (SNPs) and therefore a common ancestor.
It is easy now to see why knowing much about haplogroups
helps us better understand the migrations patterns of ancient humans out of Africa and MtDNA variations (mutations) in humans today.
About half of the MtDNA mutations appear to have occurred in approximately
the last 70,000 years, that is after the migration out of Africa.
That over a half of the 50 mutations took place in Africa, shows just how old African MtDNA is.
N.B.
The worldwide genetic maps below (for the sake of simplicity for readers of this ebook) only shows a grand total of 22 haplogroups. That is
22 major Mitochondrial DNA markers. It does not show all the 36 major Mitochondrial DNA or MtDNA markers.
In 2016 geneticists universally agreed that there are 36 major haplogroups, i.e.
36 major Mitochondrial DNA markers or 36 major genetic markers.
WORLDWIDE GENETIC MAP (MtDNA) OF HUMAN MIGRATIONS OUT OF AFRICA, 70,000 years ago
Showing 22 out of the 36 major MtDNA Markers (36 major MtDNA haplogroups).
Once these ancestors of the L3 haplogroup left Africa 70,000 years ago, and while in the Middle Eastern portion of Bab al-Mandab in Yemen,
over several hundred years, before migrating to Europe and Asia
the L3 haplogroup changed into two new haplogroups, possibly due to sudden adverse climatic factors moving from Africa to the Middle East.
Biologists call this genetic change a mutation. The new name
given to this mutation or genetic marker is the N and M haplogroups.
Although Anatomically Modern Humans evolved 200,000 years ago, it was several thousands of years before any migration out of Africa was attempted.
The L3 migration out of Africa took the Southern Route 70,000 years ago via the narrow Bab al-Mandab Strait.
The N (Nasreen) and M (Manju) genetic markers are shared by all humans today whose ancestry is outside Africa, i.e. only Europeans, people from
the Middle East and Asians (including Melanesians and Polynesians in the Pacific Ocean) have the N and M genetic markers in their DNA. However, although the M genetic marker
originated outside Africa, if you look at the worldwide genetic map shown above,
you will see that the M genetic marker is also shown in East Africa (it is more properly termed M1 marker). The reason for this was because of back-migration: ancient people carrying the
M genetic marker were driven back to Africa from the Middle East due to factors such as the climate
change caused by the Last Glacial Maximum. Only the N genetic marker is exclusively non-African.
The nicknames of N (Nasreen) and M (Manju) genetic markers was given by some geneticists, due to
revised proposed Middle Eastern and Indian origins of the N and M genetic markers.
According to the exciting two-part BBC TV documentary series shown in March 2013 Meet the Lzzards
because of the high concentration of the N and M markers found in people living along the coast of
Yemen today,
the narrow Bab al-Mandab strait, shown below is now proven to be the very place where modern
humans first arrived from Africa, circa 70,000 years ago, before moving on to populate the rest of the world.
How on Earth Did Ancient Humans (L3) Manage to Cross the Bab al-Mandab Strait 70,000 Years Ago Anyway?
Pause for a moment and reflect on how humans have travelled to all four corners of the earth. As noted earlier on in this eBook, our human ancestors first migrated beyond Africa during the time of
Homo erectus. Later on Homo heidelbergensis was the next species of human ancestors to migrate out of Africa to the rest of the world. These two
first migrations ONLY involved land routes (from Africa to the rest of the world via the Sinai).
Our human ancestors back then were just too primitive to figure out how to make a simple boat and cross rivers or seas. By the time Homo sapiens are
about to embark on the next major migration out of Africa, they did not use the Sinai route, this time they were intelligent enough
to attempt the first ever sea or river crossing by our ancient human ancestors.
Two sources among others provide very good answers on how this sea crossing was possible: the journal Scientific American, July 2008 issue: Traces of a Distant Past by Gary Stix, AND
Mapping Human History: Discovering Our Past Through Our Genes by Steve Olson.
From these sources we learn that ancient humans as early beachcombers used small rudimentary boats (ancient crude rafts) to cross the warm Bab al-Mandab strait 70,000 years ago.
The strait is a mere 12 miles wide today, but was much shorter (about 6 miles or less) 70,000 years ago and Red Sea levels were not the same 70,000 years ago. The Red Sea water levels around the Strait 70,000 years ago were more shallow water (shoal) than deep water today.
Furthermore 70,000 years ago, sea levels were 230 feet lower due to the onset of Last Ice age conditions
that locked up water in vast polar ice caps. With some kind of raft, and perhaps a few islands
to hop between, such a crossing is not difficult to imagine. Professor Chris Stringer (U.K. Natural History Museum) has calculated that for anatomically modern humans in Africa to have reached Australia 60,000 years ago (i.e. Mungo Man fossils), they only had to travel only one mile each year for next 10,000 years to reach Australia, having left Africa 70,000 years ago. Bear in mind that anatomically modern humans were hunter-gatherers moving from place to place every few hours (nomadic lifestyle) and only settled down 10,000 years ago.
Evidence of Ancient Humans as Early Beachcombers in Eritrea and Djibouti
In 1999 an international team of marine biologists, palaeontologists, archaeologists led
by Dr C Walter discovered
startling evidence of ancient human habitation
near the village of Abdur on Eritrea's Red Sea coast, (Eritrea is Djibouti's nearby neighbour). It was dated 125,000 years old. The evidence shows
that before finally leaving the Djiboutian and Eritrean coasts for Yemen 70,000 years ago, ancient humans
had been
beachcombers on the east African coasts for thousands of years. The discovery was
published in Nature journal in May 2000.
Source:
Early human occupation of the Red Sea coast of Eritrea during the last interglacial
Nature 405, 65-69 (4 May 2000).
If you have been reading this ebook properly from the start, I mentioned some amazing stuff about the
Great Rift Valley in Ethiopia and the Omo Valley where the Omo kibish fossil was located. Have a closer look at the map above to see something extraordinary:
the Great Rift Valley is not far from the Bab al-Mandab strait! This shows that very place
in Africa that gave us the birth of anatomically modern humans 200,000 years ago (Omo kibish) is not far from the very place where
modern humans left Africa 70,000 years ago (Bab al-Mandab strait). Ethiopia is indeed a special place for study by
anthropologists worldwide.
European MtDNA Haplogroup Lineages
There were further mutations as ancient people moved further away from Bab al-Mandab strait. For instance,
ancient people carrying the N (Nasreen) genetic marker migrating from Bab al-Mandab strait towards Europe over thousands of years developed 9 further European original MtDNA
haplogroup lineages or haplogroups (or genetic markers) named: H, I, J, K, T, U (U5), V, W, and the rare X . These mutations were influenced by factors such as by climate, environment and diet, and most importantly the invention of farming 15,000-10,000 years ago which dramatically changed the lifestyle of early people from hunter-gatherers to farmers.
For instance the presence of adult humans who can digest milk (i.e. milk sugar known as lactose via the lactase enzyme)
hence Lactose Tolerance, in Europe today,
occurred when farming (dairy farming began in western Turkey and Europe) allowed ancient people to start drinking milk and nature (via natural selection) over a long period time soon allowed a
mutation to occur to enable the lactose enzyme, normally switched off in children after ages 5 (after weaning is completed thoroughly),
to remain switched on in adulthood. A list of the other genetic mutations that occurred
from 10,000 years ago can be read in detail in the
book:The 10,000 Year Explosion: How Civilization Accelerated Human Evolution by Gregory Cochran,
published in 2009.
Asian MtDNA Haplogroup Lineages
Ancient people carrying M (Manju) genetic marker migrating east from Bab al-Mandab strait towards Asia over thousands of
years developed 8 further original Asian MtDNA haplogroup lineages or haplogroups named:
F, B, Z, A, C, D, G, Y .
As the genetic map shows, the M genetic marker managed to stay unchanged (no mutations) as it made its way
from Yemen onto southern India onto Australia (48,000 years ago). It is thus the
oldest MtDNA Haplogroup genetic marker found in Asia. The M genetic marker also made its way onto Melanesia, Micronesia and Polynesia in the Pacific Ocean.
Differences Between Haplogroups and Haplotypes
As previously noted, a haplogroup is a huge group of people with the same genetic descent,
recognised by characteristic mutations i.e. SNPs.
All the 19 Asian and European genetic major markers or haplogroups shown in the world map below,
over time, further mutated into several subgroups or branches known as subclades or
sub-haplogroups For instance the H MtDNA Haplogroup genetic marker mutated into over
30 sub-haplogroups such as H2, H33, H4, H5, H6, H7 to H16, then further mutated into subclades of sub-haplogroups such as H1a, H1c, H2b H3c, etc etc.
As noted earlier on in the section about SNPs, haplogroups are determined by a
method which looks for markers (or mutations) on the MtDNA sequences known as
SNPs or single nucleotide polymorphism sites. Meanwhile haplotypes are simply a combination of closely
linked MtDNA sequences that are often inherited together. Haplotypes occur on
both MtDNA and the 23 chromosomes
in nuclear DNA.
Put in another way:
The individual mutations (SNPs) in your MtDNA that
set you apart from others are called Haplotypes. AND people
who share particular patterns of mutations in their haplotype
fall into clusters called Haplogroups.
Haplogroups are useful for evolution scientists who are studying very ancient human migration patterns over several thousands of years (maximum 200,000 years or thereabouts) and has huge archaeological value, i.e.
providing a broad knowledge of the geographical area that your ancestral line originated and migrated from Africa.
Meanwhile haplotypes
provide mostly accurate genealogical information and linking family lines, so good for tracing
ancestry less than 2000 years old. When one submits DNA for an ancestry or paternity tests, haplotypes are analysed. Likewise when one
submits DNA for evolution research projects on ancient human migrations,
it is the haplogroups, sub-haplogroups and subclades that are analysed.
We recall earlier on in this ebook, I explained that Single Nucleotide Polymorphisms or
SNPs are swaps of one nucleotide for another at a particular spot in MtDNA. A person normally has
two forms of a gene or pairs of the same genes (one from each biological parent). These gene pairs are called alleles.
Since
Alleles ARE alternative versions of a gene , it follows that a haplotype is a SET of alleles, or differing forms of genes, that occur close to one another
on a chromosome and tend to be inherited together.
Still confused, with regard to haplogroups and SNP?
Let's step back a bit then......
About 10 million SNPs exist in human populations worldwide,
Alleles of SNPs that are close together tend to be inherited together.
A set of associated SNP alleles in a region of a chromosome is called a haplotype. In other words a haplotype
is any specific SNP on a Y-Chromosome or MtDNA. Using Y-Chromosome haplotypes, the ancestry of any male can be traced through his paternal lineage. Likewise
Using MtDNA haplotypes, the ancestry of any female can be traced through her maternal lineage
Most chromosome regions have only a few common haplotypes,
which account for most of the variation from person to person in a population.
A chromosome region may contain many SNPs, but researchers can use only a few "tag" SNPs
to obtain most of the information on the pattern of genetic variation in the region.
Therefore the best definition of the difference between haplogroup and haplotypes is:
A haplogroup is a group of similar haplotypes that shared a common ancestor thousands of years ago,
via shared SNPs. In other words, a haplogroup is a group of people who all share the same pattern of
SNP in their MtDNA or Y-Chromosome DNA.
For instance all the haplotypes of the sub-haplogroups H2, H33, H4, H5, H6, H7 etc
all belong to the MtDNA haplogroup H and share the same SNPs.
In genetics, a subclade is a subgroup of a haplogroup.
What is a Genotype?
Each person has normally two copies of all chromosomes (one from each parent), except for the sex chromosomes. Since a chromosome is where genes reside, it follows that
each person has normally TWO copies of genes (in mutations a third version of a gene is possible) .
These two gene copies are known as alleles.
The set of alleles that a person has is called a genotype. Put in another way: the genotype is a list of the alleles present at one or a number of loci, (a locus, plural loci, is a unique chromosomal location defining the position of an individual gene or DNA sequence).
The term genotype can refer to the SNP alleles that a person has at a particular SNP site, or
for many SNPs across the genome. A method that discovers what genotype a person has is
called genotyping. In population genetics research knowing a person genotype alongside his or her haplogroups and haplotypes helps a lot.
What is a Phenotype?
A phenotype is the physical characteristics expressed by a genotype: For instance blue eyes is a phenotype, which is the end result of the persons alleles for eye colour, (i.e the eye colour genotype).
What is Genetic Drift?
Each time a mutation in genes on the chromosome or in mitochondria occurs, it continues as a mark on future generations. Genetic drift explains
how this mutation spreads
and how the effectiveness of its spread is related to the number of individuals in a group. If a population is small,
its chances of success are increased because genetic drift is more effective in changing the genetic pattern.
Also the longer the group remains in one place, the more mutations it will have. More precisely, one version of
a gene, especially in small population, can displace all existing versions of the same gene in a few generations,
through a purely random process. And this process is genetic drift. Using the theory of Genetic drift explains
why we have Mitochondrial Eve
and Y-Chromosome Adam (the Y-Chromosome DNA, via genetic drift, of all other males, in the original small population of our human ancestors
around the time of Y-Chromosome Adam, at some point in time all perished, leaving just the Y-Chromosome DNA of Y-Chromosome Adam).
What is a Homoplasy?
Sometimes while analysing MtDNA data carefully in a lab, following extraction and sequencing and
trying to come up with
reliable and accurate
molecular clock calculations and mutation rate calculations, to construct reliable phylogenetic trees, the results can vary greatly
in different labs doing the same research work! Confusing and conflicting results
do not may mean errors were made in the lab. Instead Homoplasy has crept in!
Genetic marker duplication from independent identical mutations is called
homoplasy. These duplications cause confusing dates in phylogenetic trees, since molecular clocks
depend greatly on accurate mutation rate calculations. Mitochondrial DNA has much higher
levels of homoplasy owing to its more frequent recurring mutations compared to Y-Chromosome DNA.
While Mitochondrial DNA has a high level of homoplasy approaching over 30%, Y-Chromosome DNA has a low level of
homoplasy of about 2%. The low homoplasy in the Y-Chromosome phylogenetic trees implied that it
contained more accurate phylogenetic
information than mitochondrial DNA phylogenetic tree. Recall that in 1987, research work of
the University of Berkeley team led by Professor Alan Wilson, had created a
phylogenetic tree, with DNA molecular clocks measurements putting the date of Mitochondrial Eve
as 200,000 years ago. But when other scientists independently tried to recreate the research work months later
some got dates that were much lower than 200,000 years ago. When scientists discovered homoplasy was rife in MtDNA,
they discovered that homoplasy was the chief cause for the other confusing dates. So taking into account
30% homoplasy in MtDNA, the date of Mitochondrial Eve as 200,000 years ago is spot on:
Anatomically modern man appeared 200,000 years ago.
WORLDWIDE GENETIC MAP (MtDNA) OF HUMAN MIGRATIONS OUT OF AFRICA, 70,000 years ago
Showing 22 out of the 36 major MtDNA Markers (36 major MtDNA haplogroups).
The omitted genetic markers include E (a southeast Asian haplogroup common in and around Indonesia),
HV (a European and western Asian genetic marker originating in Turkey) and R (very old southeast Asian haplogroup, together with the M
haplogroup, they are the oldest haplogroups found in southeast Asian and the Pacific Ocean islands).
All the above haplogroups have further divisions. In genetics, a subclade is a subgroup of a haplogroup.
Subclades can also be called sub-haplogroups and haplogroups can also be called Clades
The complete list of the 36 major MtDNA haplogroups are: A; B; C; CZ; D; E; F; G; H; HV; I; J; Pre JT; JT; K; L0; L1; L2; L3; L4; L5; L6; M; N; P; Q; R; R0; S; T; U; V; W; X; Y; Z
Sometimes there is a union of two haplogroups such as H and V, this is indicated by juxtaposed letters HV.
Brief Summary of some of the haplogroups shown in map above
M as noted earlier on, is obviously a huge haplogroup, since it is the oldest Asian haplogroup, it is also
the ancestor of all Asian haplogroups. It is dated 65,000 to 70,000 years old. Its sub-haplogroups
includes M1 (East Africa only), M2, M3, M4, M5, M6, M7 up to M91. It is very common in the Middle East and western Asia such as Turkey and Israel. Most of the M sub-haplogroups are also found in southern Asia, Melanesia and Polynesia.
A is much common in both East Asia and the Americas (North and South American original indigenous people, such as the Native Americans and descendants of the Incas of Peru). The ancient The Ainu or the Aynu populations in Japan also have this marker, but not the majority of today's Japanese population (they belong to the G haplogroup).
B is widely distributed in Pacific Ocean islands (as map above shows), central Asia,
southeast Asian and the Americas (just like the A haplogroup). Sub-haplogroups include B1 to B5.
C is much common in both north East Asia and the Americas.
D also common in both north East Asia and the Americas.
F occurs mostly in central and in particular southeast Asia where it is the most common haplogroup alongside the B haplogroup.
G is more common, i.e. highest frequency is in northeastern Asia (China, Tibet, Mongolia, Eastern Russia, Japan (excluding The Ainu or the Aynu), Korea, etc).
Y is a mostly east Asian haplogroup.
Z is more common in central Asia and Siberia.
The European genetic markers such as H, I, J, K, T, U (U5), V, W, X are all are discussed in great detail
later on in the part of the genetics tutorial title: A Special Look At European MtDNA Haplogroup Lineages.
The African genetic markers, L1, L2 and L3 are also discussed in great detail later on.
As discussed earlier on the N genetic marker is
is obviously a huge haplogroup, like the M haplogroup. Since it is the oldest European haplogroup, it is also
the ancestor of all European haplogroups. It is dated 65,000 to 70,000 years old.
It is very common in the Eastern Europe, the Middle East and Western Asia. Its sub-haplogroups includes N1 to N22. N1 and N2 are very common in Eastern Europe and South Western Asia (Turkey, Georgia, Armenia, Azerbaijan, Cyprus, Lebanon, Israel, Jordan, Syria, Iraq, Iran etc).
To a small extent some N sub-haplogroups are also found in southeast Asian, such as N12 and N13 (Australian aborigines).
Although the M genetic marker
originated outside Africa, if you look on the genetic maps given above,
you will see that the M genetic marker is also shown in East Africa (it is more properly termed M1). The reason for this was because of back-migration: ancient people carrying the
M genetic marker were driven back to Africa from the Middle East due to factors such as the climate
change caused by the Last Glacial Maximum. Only the N genetic marker is exclusively non-African today.
The excellent text Human Mitochondrial DNA and the Evolution of Homo sapiens (2006)
provides a detailed explanation of European, African and Asian MtDNA haplogroups.
In detail: MtDNA and Y-DNA HAplogroups This link provides a detailed explanation of the two types of human haplogroups.
How Does Genetics Show an African Origin of Humanity?
In the books The History and Geography of Human Genes
and Genes, Peoples and Languages both written by Professor Emeritus Luigi Luca Cavalli-Sforza (in 1994 and 2001 respectively), we learn that
all non-Africans such as Europeans and Asians still have the African L3 genetic marker in their genome.
Although over thousands of years the L3 genetic marker mutated into new major genetic markers such as the
European genetic markers H, I, J, K, T, U (U5), V, W, X and Asian genetic markers F, B, Z, A, C, D, G, Y, the
original L3 genetic marker is retained, since it was the root of other non-African genetic markers, M and N.
During DNA profiling using MtDNA for Europeans and Asians, the first two major genetic markers to show up are the African L3, then M (for Asians) and African L3, then N (for Europeans).
Likewise during DNA profiling for European and Asian males using Y-Chromosome DNA, the first major genetic markers to show up is the African genetic marker M168.
For instance since the T genetic marker in MtDNA is prevalent in southern Europe, for a typical native-born Greek
person MtDNA (we nickname Aristotle), the first 3 major genetic markers show up as L3, N, T followed by other smaller divisions
such as T2 and T2b, i.e. L3, N, T, T2, T2b. Therefore the order of these markers,
during DNA profiling allows scientists to trace the journey taken by human ancestors thousands of years ago
as they migrated out of Africa into Europe, Asia and the Americas.
E.g. the order of L3, N, T, T2, T2b, shows that Aristotle's ancestors took a route from
East Africa onto Yemen, then took a north western route that passed Saudi Arabia, Jordan, Syria, and Turkey, before reaching Greece.
When a person submits their MtDNA for DNA ancestry testing (DNA profiling using MtDNA), the tests can either use the whole MtDNA or just the MtDNA D-Loop.
For instance the test known as mtFullSequence (FMS, FGS) is a complete MtDNA test, providing detailed information on
haplogroups, sub-haplogroups, subclades etc. Meanwhile the test known as mtDNAPlus
only uses the MtDNA HVR1 and HVR2 hypervariable regions and only gives basic haplogroup information. For instance L3, N, T, T2, T2b will be the result of a
basic mtDNAPlus test.
The above diagram helps explain the African origin of humanity.
During DNA profiling of a Native American Indian male in the US and Canada,
using Y-Chromosome DNA, the first major genetic marker to show up is the African M168 marker which originated in Africa.
Y-Chromosome DNA markers are discussed later on in this ebook. All male humans today who ancestry is outside Africa have the M168 marker in their genome. It is sometimes called Eurasian Adam the common ancestor of every male today outside of Africa.
The above diagram is a good example of DNA profiling showing migrations routes.
In the diagram above for example, we see that the order in which the markers appear also
show us the exact route taken by the ancestors of Native Americans from Africa to the Americas.
M91 Africa (120,000 years ago) 
M168 East Africa (70,000 years ago)
M89 Middle East (50,000 years ago) M9 Central Asia (40,000 years ago) M45 Central Asia (30,000 years ago)
M242 East Asia (28,000 years ago) M3 the Bering Straits en-route to North America, the final destination (10,000 to 20,000 years ago).
For the non-geneticist, there are a few books that explain the relationship between haplogroups, migration and ancestry. One such book is
Bound Together: How Traders, Preachers, Adventurers, and Warriors Shaped Globalization
by Nayan Chanda (ISBN-13: 9780300136234, published in 2008). Mr Chanda is an economist and managed to write a good book with a section
on human evolution for anyone but geneticists. His book explains how globalization
first began when the first humans left Africa circa 70,000 years ago in search of a better life.
His first chapter is titled: "The African Beginning".
He argues that the globalization process has been driven after that first African migration, principally over hundreds of centuries
by four types of humans: traders, preachers, adventurers and warriors.
Lasse Berg (who’s lived over ten years in Africa and travelled the world studying human origins) is a Swedish writer, journalist and documentary filmmaker who has managed to write a very
fascinating book about human migration out of Africa 70,000 years ago. His book titled
Dawn Over the Kalahari : How Humans Became Human was published/translated into English in 2011 (ISBN-13: 978-9186528102) .
Why are Alphabetic Letters Used to Designate Human MtDNA Genotype Lineages?
The use of letters to designate human MtDNA genotype lineages (i.e.haplogroups) was first proposed by
Professor Douglas C Wallace, a geneticist in the late 1980s. Research into human MtDNA (Mitochondrial DNA) as a genetic marker was first pioneered by Dr Wesley Brown and
Professor Douglas C Wallace (University of Pennsylvania) in the middle 1970s using low-resolution restriction enzyme analysis.
Video of Professor Douglas C Wallace explaining Haplogroup Lineages At this web site
Professor Douglas C Wallace explains the various
alphabetic letters he chose to represent genetic markers or Human MtDNA Haplogroup Lineages found in
Africa, Europe and Asia.
In 1989
geneticist Antonio Torroni, senior Professor of Genetics at the University of Pavia in Italy, also proposed
the use of letters to designate human MtDNA genotypes.
Soon other
geneticists agreed upon the universal idea of using alphabetic letters designate human MtDNA haplogroup lineages (as well Y-Chromosome haplogroups to be discussed later).
The link below
provides a simple explanation of the human MtDNA haplogroup lineage for non-geneticists.
The 635 page Human Evolutionary Genetics by Mark Jobling, Edward Hollox et al.
ISBN-13: 978-0815341482, has a much detailed section on the use of alphabetic letters to designate
human MtDNA haplogroup lineages, as well human
Y-Chromosome haplogroup lineages. It has lots of detailed diagrams as well.
Mark Jobling is a Professor of Genetics at the University of Leicester, Britain.
Understanding the Alphabetic Letters
used in the Human MtDNA Haplogroup Lineages
In detail: MtDNA and Y-DNA HAplogroups This link provides a detailed explanation of haplogroups.
A Special Look At European MtDNA Haplogroup Lineages
Top evolutionary geneticist Professor Bryan Sykes (Oxford University in Britain) however does not agree with the 9 further
original European MtDNA haplogroup lineages, he says they were fewer, and suggests 7 not 9 MtDNA haplogroup lineages.
He explained all this in his fascinating and enjoyable book:
The Seven Daughters of Eve giving each of the 7 MtDNA haplogroup lineages a female name.
His book provides an incredible account of how the descendants of Mitochondrial Eve reached Europe
from Africa 45,000 years ago,
and how the ancestry of 99% of all Europeans can now be traced back to these seven women.
N.B. There were of course hundreds or thousands of women alive, alongside Mitochondrial Eve, at
the same time and place in Africa 70,000 years ago, but only these seven women’s descendants have survived
through the maternal line to modern Europeans today.
Ursula: corresponds to Haplogroup U (more specifically called U5), She had the oldest MtDNA, dated about 46,000 years ago.
She also had the 2nd most common haplogroup at 17% of today's European population.
Her haplogroup is particularly common in the Mediterranean countries such as Turkey, Greece, Italy, Albania and Croatia.
Because of the age of this haplogroup, it was her ancestors, as the Cro-Magnons, who first encountered the Neanderthals, and
alongside with the other European haplogroups thousands of years later
drove Neanderthals to extinction. However the U haplogroup is not however exclusively European. Her
sub-haplogroups are also found in North Africa, the Middle East such as Israel, and western Asia. For example U3 occurs in the Middle East, U7 in Iran, and U6 occurs in North Africa (70% of the population today).
Meanwhile U2 occurs in south Asia. For this reason we use U5 to specifically denote the U haplogroup subclade division specifically found in Europe.
Hence U5 is the oldest MtDNA subclade found in Europe at 45,000 years old.
Ursula is considered the daughter of Europa.
The name Europa is the name of the proposed mother of
U5 haplogroup, so the mother of the first European-specific lineage to evolve from the N haplogroup.
Dr Stephen Oppenheimer in his enjoyable book: Out of Eden: The Peopling of the World
actually calls the (U5) Haplogroup, Europa and not the mother of the U (U5) Haplogroup.
Anyway, since the genetic map
above, clearly shows the N marker originating in the Middle East, Europa simply marks the start of the
lineage that went into Europe proper (via Turkey) about 50,000 years ago before leading to the U5 marker 45,000 years ago.
Xenia: corresponds to MtDNA Haplogroup X, her MtDNA is 25,000 years old, she was mostly based in northern, central and eastern Europe, she is the only European haplogroup who also managed to reach northern Asia via Siberia and spread to the Americas (as seen in Sioux, the Nuu-Chah-Nulth, the Navajo and the Yakama native Americans who all possess this particular marker) via the Bering Straits. However she has the 2nd least common haplogroup at 7% of today's European population. Some X sub-haplogroups such as X1 are found in North Africa as well.
Helena: corresponds to MtDNA Haplogroup H, her MtDNA is 23,000 years old, her clan concentrated
all over Europe. She has the most diverse and most common MtDNA haplogroup at 49% of today's
European population. Hence she has the largest number of sub-haplogroups (more than 100 ssub-haplogroups are known)
Velda: corresponds to MtDNA Haplogroup V, her MtDNA is 17,000 years old,
she concentrates in western, central, and northern Europe. She the least most common MtDNA haplogroup at just 5% of today's
European population. This is because much of her descendants perished during the Last Ice Age (hardest hit). Strangely she is
is found in around 25% of Basques of southern Spain and 33% of Skolt Saami of northern Scandinavia. Haplogroup V is a good example of the effect that population dynamics, such as bottleneck events, founder effect, genetic drift, and rapid population growth, have on the genetic diversity of resulting populations.
Tara: corresponds to MtDNA Haplogroup T, her MtDNA is 18,000 years old.
Her members were also concentrated in Northwestern European, and the south such as Italy and Greece.
Katrine: corresponds to MtDNA Haplogroup K, her MtDNA is the 2nd youngest found in Europe at
15,000 years old. She was among the last haplogroups to evolve from the N haplogroup.
Her members where the first to farm and domestic plants and animals in Europe,
about 7,000 years ago, which was later picked up by all other haplogroups as the culture of farming spread all over Europe.
Jasmine: corresponds to MtDNA Haplogroup J. She had the 3rd most common haplogroup
at 16% of today's European population, but her MtDNA is the youngest MtDNA found in Europe at just 10,000 years old. Where very active in agriculture. She concentrates in
northern Europe, such as Britain, Ireland, Scandinavia, the Netherlands and northern Germany. Also found in southern Europe.
Some of her sub-haplogroups are found in the Middle East and Wetern Asia.
Omitted from Professor Sykes book were the markers MtDNA I and MtDNA W.
I haplogroup is found throughout Europe (low frequencies) and West Asia such as India.
It dates 20,000 years ago.
W haplogroup dates from 16,000 years ago. Found throughout Europe (on a small scale) and West Asia
Highest frequencies exist in Finland (9%), Hungary (5%), Latvia (4%), Macedonia (4%), Belarus (3.5%), Pakistan (8%), Tajikistan (6%), India (5%) and Iranians (3.5%).
There is however universal agreement from all evolutionary biologists that most
common MtDNA genetic lineage found in Europe was the H MtDNA genetic marker.
It is found exclusively in 49% of all European population today (a very huge number in genetics)
It is not surprising that the H haplogroup has been thoroughly sequenced and available for researchers (
who thus do not have to do the painstaking task of MtDNA extraction and sequencing). One of the best available
source for H haplogroup/haplotype sequences is the British Cambridge Reference Sequence database or CRS. Meanwhile
the National Centre of Biotechnology
Information (or NCBI) in the U.S. (part of the National Library of Medicine, itself a department of the National Institutes of Health) has over 3,700 completely sequenced human mitochondrial genomes from different ethnicities
and now available for study at the huge Entrez Nucleotide Database (website is http://www.ncbi.nlm.nih.gov/sites/gquery). Meanwhile a huge database of
sequenced nuclear DNA is available for researchers at the Paris-based Centre for the Study
of Human Polymorphisms. Finally the Ensembl database (website is http://www.ensembl.org/index.html) is a huge genome database of animals, plants and humans and popular for human ancestry studies due to its
huge collection of Single Nucleotide Polymorphisms (SNPs) in human ethnic groups. Thus all over the world, right after the massive $2.7 billion Human Genome Project
was completed in 2003, scientists have sequenced thousands of MtDNA and nuclear DNA from different ethnicities and
made this available for other scientists to use for research. This saves time
from doing the painstaking task of several man-hours of MtDNA extraction and sequencing.
Only in forensic science in police stations, ancestry tests or court-ordered paternity / maternity cases,
is it necessary to extract and sequence fresh nuclear DNA or MtDNA for identification purposes. E.g. via
(genetic finger printing) for nuclear DNA identification invented in 1994 by British molecular geneticist Dr Alec Jeffreys . Short repetitive nucleotide segments in
nuclear DNA (known as Microsatellites or Short Tandem Repeats or STR) are used for the
identification purposes. Microsatellites are discussed later on in this ebook.
U.S. National Library of Medicine NCBI scientific paper on the H genetic marker A bit technical!
NEW UPDATED DATA
Although the enjoyable book, The Seven Daughters of Eve shows how the ancestry of 99% of all Europeans can now be traced back to just seven women,
in May 2015, scientists at the University of Leicester in Britain led by Professor Mark Jobling and Dr Chiara Batini have uncovered a more stunning fact:
Most European men descended from just three male ancestors (from the Bronze Age period). Unlike Professor Bryan Sykes who used MtDNA for his discoveries,
the University of Leicester scientists used another type of marker known as Y-Chromosome DNA.
Later in this ebook is a very detailed examination Y-Chromosome haplogroups. But here is a brief summary.
The most common Y-Chromosome DNA haplogroup in Europe
is the R haplogroup representing over 75% of the native population of Europe. The R haplogroup itself
is composed of smaller sub-haplogroups
such as: R1b (Western Europe) and R1a (Central and Eastern Europe).
The next most common haplogroup in Europe is the I haplogroup.
(one of the oldest Y-Chromosome DNA Haplogroups in Europe and associated with the ancient European Gravettian Culture). The
I haplogroup sub-haplogroups such as I2 and I1 covers 10% of European population,
but it is particularly found in larger frequencies in Scandinavia (Iceland, Norway, Denmark and Sweden). What the University of Leicester scientists discovered was that,
three distinct mutations occurred in 63% of the 700 male volunteers they tested. The mutations were found in the R1a, R1b and I1 haplogroups.
Clearly back in the Bronze Age, three ancient men (each one carrying the R1a, R1b and I1 markers)
are the ancestors of over half of European males today.
The Americas MtDNA Haplogroup Lineages
From 20,000 years ago, a group of people living in Eastern Asia crossed the Bering Straits
(back then it was a frozen ice land bridge, due to the last Ice) into the Americas carrying the Asian MtDNA haplogroups B, A, C, D
and the European X MtDNA haplogroup. Descendants of Native Americans, and the Olmecs, Mayas, Aztecs and Incas in North and South America as well as the original inhabitants of the Caribbean Islands all inherited these Asian MtDNA haplogroups.
If there had been no frozen land bridge at the Bering Straits, it is then likely that the Americas would have been
colonized by
early humans much later in time. Today the Bering Strait separates the Asian (Russia) and North American (Alaska, USA)
continents by
a mere 53 miles! Prior to the development of MtDNA research and the understanding of human ancestry in the late 1980s and early 1990s, anthropologists had to rely on phenotypical studies, noting facial similarities between East Asians and Native Americans in Canada and the U.S.
Molecular genetics also solved the debate about the origins of the Polynesians in places like Samoa and Tahiti. Back in 1947,
Thor Heyerdahl, the extra-ordinary Norwegian ethnographer and adventurer, with a background in biology, zoology, botany, and geography, undertook his famous
Kon-Tiki expedition. He sailed from Peru, westwards towards French Polynesia
to attempt to show that Polynesian ancestors came from the Americas and not Asia.
Evolutionary biologist Professor Bryan Sykes explained in his book The Seven Daughters of Eve that this was unfortunately not correct because
several independent MtDNA studies now show that Polynesians have the M haplogroup and
could have only inherited it from Asia, and not the Americas (see diagram below).
The Asian M haplogroup only exists in Asia and the Pacific Ocean islands (as the diagram below shows).
N.B. Remember it is actually genes in the cell's nucleus DNA that determine ethnic group, and not the genes in the mitochondria DNA (MtDNA).
While MtDNA mutations tell us when and where exactly different ethnic groups emerged around the world at different points in time via migration out of Africa,
for each point where a different MtDNA marker arose (due to mutation in MtDNA), we can say with certainty that a corresponding mutation in nuclear DNA
had occurred just before or after the mutation in MtDNA,
leading to a specific genetic trait.
For instance the genes that control skin colour, via regulating the production of melanin, are only found in the nucleus.
MtDNA tells us that about 70,000 years ago once ancient humans left Africa and entered Yemen, a mutation occurred leading to a different MtDNA marker.
Thus likewise 70,000 years ago a mutation occurred in the nuclear DNA (at chromosomes 15, 16 and 19) that led to a specific genetic trait:
different skin colour pigmentation. In all human cells, chromosome 15, 16 and 19 in the nucleus determines skin, hair and eye colour of an individual.
With this in mind, you may wonder: Did some sort of commuication occur between MtDNA and nuclear DNA? Which mutation was triggered first, MtDNA or Nuclear DNA?
Scientists do note that although genes in MtDNA and nuclear DNA are different in function MtDNA DOES exchange signals with nuclear DNA.
How and why these exchange of signals occur is
beyond the scope of this eBook.
African MtDNA Haplogroup Lineages
Homo sapiens remaining in Africa (those who did not take part in the human migration), i.e. today’s Africans,
are all descended from four main haplogroups: the L0, L1, L2 and L3 haplogroup.
The letter L is sometimes called Lara just as the M and N haplogroups are sometimes called Manju and Nasreen respectively.
Professor Bryan Sykes was the originator of the name Lara, and is also gave names to the 7 common MtDNA haplogroups found in Europe.
The L0 haplogroup (the root of the genetic marker or haplogroup L) is reserved for the Khoi and San or Khoisan people of the Kalahari Desert in southern Africa.
The analysis of the MtDNA of the Kho and San people suggest they not only different genetically but are much older than the rest of Africa in terms of
ancestry. This means today the Kho and San people are the 2nd oldest surviving humans on Earth (after the ancient Mbo ethnic groups in western Cameroon).
It was the unusual high genetic variation among the Khoisan people people that amazed biologists and anthropologists around the world. As noted earlier on in this ebook,
99.9% of the human population today (excluding the Kho and San people) have very little genetic variation, due adverse climatic changes like the huge Mount Toba eruption discussed earlier on. However in the Kalahari Desert, Khoisan people have very high genetic variation compared to other humans. In genetics, it is a fact that Mitochondrial DNA is passed down to new generations of humans exclusively through the maternal line, and the longer a population has existed on earth, then the more genetic variation accumulates in its MtDNA lineages. This was the case of the Khoisan people when their DNA was analysed. More details about the Khoi and
Khoisan people are discussed later below in this ebook. There are further mutations of the
L haplogroup. Recall earlier on that I mentioned that scientists Cann, Wilson and Stoneking in 1987 had produced a phylogenetic tree that
showed that the root of the tree in Africa.
This tree root was later called the L haplogroup. The work of Cann, Wilson and Stoneking on the L haplogroup, has indicated that
it contains seven major branches: L0, L1, L2, L3, L4, L5, and L6.
Each branch has several further subgroup mutations, known as sub-haplogroups or
subhaplogroups such as L1a, L1d, L1f etc. Evolutionary biologists all agree that the African
L haplogroup is in fact the oldest known human haplogroup,
because it has the most mutations or the most further sub-haplogroups and subclades. Put in another way: African populations have the most ancient alleles [gene pairs that code
for specific traits] and the greatest genetic diversity, which means they're the oldest ancestry in humans today.
Meanwhile the L0 haplogroup (Kho and San people) has the highest overall mutations or highest overall
sub-haplogroups such as L0a, L0b, L0k, L0f etc.
The map above shows just how old African Mitochondrial DNA markers are, the oldest being the L0 marker.
The Khoisan People However Do Not Have The Oldest Current Ancestry in The World.
While it is true that the oldest MtDNA markers in the World (i.e. L0 MtDNA haplogroup) are found in the San and Kho people of the Kalahari Desert, the
San do not have the oldest possible haplogroup. Later on in this ebook, we will have a good look at very different type of genetic marker:
The Y-Chromosome DNA Genetic Markers.
It has been proven scientifically that the Mbo ethnic groups and Bangwa ethnic groups in
western Cameroon carry the very ancient 338,000 year old A00 Y-Chromosome DNA haplogroup. Meanwhile
the Bakola ethnic groups of south western Cameroon carry the ancient 190,000 year old A0 Y-Chromosome DNA haplogroup
These markers are thus much OLDER than the Khoisan people's L0 MtDNA haplogroup (which is 185,000 years old).
Meanwhile the Kho and San people L0 genetic marker is roughly 185,000 years old.
The African L1 and L2 genetic markers are about 150,000 to 130,000 years old.
The
East African L3 genetic marker is about 90,000 years old.
Meanwhile the non-African N and M genetic markers are 70,000 to 50,000 years old.
The oldest European marker, the U genetic marker is 45,000 years old.
The most common European marker, the H genetic marker is 22,000 years old.
Evolutionary biologists in DNA projects in Europe, China and the U.S. used
mostly MtDNA from the maternal (mother's) line from hundreds of volunteers from Africa, Europe and Asia, over a decade to get these age estimates.
Introduction to Human Y-Chromosome DNA haplogroups
To get a full complete genetic picture of evolution using genetic markers, the
human MtDNA haplogroup (lineages) are not the only genetic markers used. Scientists such as
Professor MF Hammer (University of Arizona), Dr Peter A. Underhill (Stanford University) and
Professor Spencer Wells (Cornell University), among others have all shown that Human Y-Chromosome DNA haplogroups or Y-DNA lineages can also used.
Dr Peter A. Underhill (Stanford University) one of the earlier pioneers of tracing human history through genetic mutations using Y-Chromosome DNA, (instead of MtDNA) is credited for discovering the African M168 Y-Chromosome DNA genetic marker. In 2001 Underhill led a team of geneticists who sampled 12,000 different Y-Chromosome DNA submitted from East Asia looking
for 3 specific mutations on the Y-Chromosome known to have originated in Africa,
one of them being the M168 mutation. The researchers later found that every one of
the 12,000 different samples carried one of the three mutations.
Thus all humans (males) today whose ancestry is outside Africa have the M168 marker in their genome.
The original bearer of the M168 mutation is sometimes called Eurasian Adam, the common ancestor of everyone living today outside of Africa. Just as Mitochondrial DNA is abbreviated as MtDNA, Y-Chromosome DNA can be
abbreviated as Y-DNA, I will be using full title "Y-Chromosome DNA" for this ebook.
Recall at the beginning of this genetics tutorial, I explained that after MtDNA which has just 16,569 nucleotides, the next genetic entity with smaller number of nucleotides is the Y-Chromosome with 60 million nucleotides.
The smaller the number of nucleotides the better for human ancestry research and population genetics projects.
I also mentioned that
there are two ways in which DNA is changed:
one way is via recombination or crossing over of DNA (during fertilization of egg cell nucleus with sperm cell nucleus, where new DNA recombinations
are randomly created by recombination of DNA from mother and father), the other way is via mutations in MtDNA or Y-DNA. Geneticists
doing ancestry or population genetics research are ONLY interested in the DNA that changes via Mutations.
In cells: both MtDNA, the Y-Chromosome DNA are not recombined, unlike nuclear DNA which is always
randomly recombined (bare in mind though as will be explained later on, very small parts of the Y-Chromosome DNA does recombine).
This time these genetic markers in Y-Chromosome DNA are
traced back via the paternal (father's) line, not the maternal line (mother's)
and the original carrier this time is called Y-Chromosome Adam.
In other words: the Y-Chromosome DNA is passed down identically from father to son,
so mutations, or point changes, in the male sex chromosome can trace the
male line back to the father of all humans.
By contrast, DNA from the mitochondria, the energy powerhouse of the cell,
is carried inside the egg, so only women pass it on to their children
(men can't because the although sperm cells have Mitochondria too,
it is located in the sperm's tail and this breaks off, once sperm cell's head enters and
fuses with the mother's egg). The DNA hidden inside mitochondria, therefore,
can reveal the maternal lineage to an ancient Eve.
While we have 36 major MtDNA haplogroups or 36 MtDNA clades as previously discussed,
we have 20 major Y-Chromosome DNA haplogroups, or 20 Y-DNA clades.
The 3rd Y-Chromosome-DNA genetic map below, shows the exact
locations of these 20 Y-Chromosome DNA genetic markers.
If you recall, at the beginning of this genetics tutorial, I explained that
MtDNA is also called Autosomal because it represents DNA not
found in the sex chromosomes
i.e. X and Y chromosomes.
All humans cells all have 23 chromosome pairs (i.e. 46 chromosomes).
Only chromosome pairs 1-22 are called Autosomes,
while chromosome pair 23 are termed sex chromosomes. While Chromosome 1 is the largest in size,
chromosome 21 is the smallest in size.
Sperm and egg cells (known as gametes) only have 23 chromosomes (no pairs here).
In the egg cell, chromosome 23 is always X version.
However in the sperm cell chromosome 23 is either X or Y version. The Y-Chromosome is very small in size, it is the
smallest of the 23 chromosomes.
During fertilisation when a sperm cell merges with an egg cell, the 23 chromosomes in the sperm
cell recombine (crossing over) with the 23 chromosomes in the egg cell
to form a zygote cell with 46 chromosomes. This
single zygote cell over 9 months divide millions of times and will grow into a baby.
If you are still curious about how a single zygote cell becomes a baby in 9 months, I suggest reading the interesting book
The Incredible Unlikeliness of Being: Evolution and the Making of Us
by Alice Roberts. Published in 2015, it is written in the style of popular science so can be enjoyed by readers from all backgrounds.
One fascinating thing about the fertilised zygote cell and early stage embryo, is that it is roughly the same size be it human, mouse, shark, or bear zygote cell or embryo!!
By the time the zygote cell has divided over several thousands times to become an embryo, cell specialisation kicks in: cells start becoming brain, skin, bone and liver cells etc, then form respective tissue and organs. E.g. bones cells develop into bone tissue and liver cells develop into liver.
What starts to differ in say a human and mouse embryos after thousands of divisions
are the active and inactive genes in the cells. For instance mice embryos have active genes such as the Sonic hedgehog gene that are also found in human embryos.
Sonic hedgehog genes tell the various animal and human embryos how, when and where to grow limbs (legs, arms, hands, digits etc). So new-born baby humans always get four tiny human limbs and new-born baby mice always get four tiny mice limbs etc. The inactive genes are a result of evolution as our common fish ancestor originally had only active genes and when fish evolved into amphibians, reptiles and mammals, some genes had to become inactive for obvious reasons. For instance, the genes that make body fur are both similar in human and mouse zygote cells, but remain inactive or switched off in human zygote cells, so human babies are born with no fur. Because the Sonic Hedgehog gene is required for normal limb development in embryos, scientists believe it
stopped working in whales sometime during the last 50 million years. This caused the members of the whale family to lose their hind legs and replace their front legs, or arms, with flippers.
The Important Issue of Non-Recombining
When two X-chromosomes in both gametes (i.e. one from each parent) recombines to
produce a female zygote cell, ALL THE PARTS of the two different
X-chromosomes will recombine with each other. However when X-Chromosome (from mother)
recombines with Y-Chromosome
(from father) to produce a male zygote cell, NOT ALL THE PARTS of the
two different chromosomes will combine.
The parts of the Y-Chromosome that DO recombine with the X-Chromosome
are called the pseudoautosomal region or PAR. Meanwhile on the Y-Chromosome is a
non-recombining part known as NRY (or Non-Recombining Y-Chromosome) This part of the
Y-Chromosome never recombines with the X-Chromosome, and so is only passed on in males from father to son.
Therefore the NRY part of the Y-Chromosome in males will be also a very powerful and
useful tool for human ancestry research and population genetics projects,
since like MtDNA, it is only inherited from either one's mother or father and not both:
inherited from only one parent (i.e. haploid).
In the above diagram of the male Y-Chromosome, notice that in-between the two PAR or
(pseudoautosomal regions) on the opposite ends of the Y-Chromosome is
the entire NRY region that DOES NOT recombine with the X-Chromosome. The entire NRY region is now also called
the MSY region or Male Specific Region and comprises 95% of the Y-Chromosome's length.
Only the PAR region of the Y-Chromosome DOES recombine with the X-Chromosome during fertilisation
(onset of pregnancy).
That the PAR region
only comprises 5% of the entire Y-Chromosome's length indicates to us just how little recombination
takes place when the Y-Chromosome pairs with the X-Chromosome during fertilisation to produce a male zygote.
In fact geneticists estimate that with the Y-Chromosome measuring 60mb or 60 million nucleotides in size,
the PAR region measures just 3mb or 3 million nucleotides in size. MSY region is called
Male Specific Region because all its genes control male characteristics such as development of testis and
testosterone hormone and other related traits such as
development of male deep low frequency voices (i.e. high bass voices) at puberty, wider shoulders, thicker arm muscles, and excess hair especially on chest, arms, legs and chin etc.
Did You Know That?
The reason why not all parts of the male Y-Chromosome recombines with the X-Chromosome is very simple to understand: both sex chromosomes are very unequal in size.
Recall earlier on that I mentioned that the Y-Chromosome is very small in size, it is the smallest chromosome in the human genome (the 2nd smallest is Chromosome 21).
Also recall that
the Y-Chromosome possess 60 million nucleotides (or 60mb with roughly 78 genes),
against 153 million nucleotides (or 153mb with 1,098 genes) for the X-Chromosome.
Clearly during fertilisation, the unequal sizes of the
two different chromosomes will be a problem. To solve this problem nature came up with a very clever idea:
Human X and Y chromosomes pair end to end rather than along the whole length, i.e. the PAR regions of a Y-Chromosome pairs with the two
ends of the X-Chromosome. Problem solved, job done!
Meanwhile the X-Chromosomes (one from each parent, leading to a female zygote)
are almost equal in size so can pair along vertically, naturally!
Also it makes sense that the MSY region of the Y-Chromosome DOES NOT
recombine with the X-Chromosome, otherwise maleness would not be manifested properly in male embryo cells !!!
Why on Earth is the Y-Chromosome so Tiny?
All the chromosomes come in two copies. Every time a cell divides, mistakes in genes can creep in (i.e. bad mutations). In paired chromosomes, that means that if there is a mistake on one chromosome, a cell can always get the correct gene sequence from the other chromosome. Recall that females have XX sex chromosomes which are almost identical in size: if there is a mistake on one X-Chromosome, a cell can always get the correct gene sequence from the other X-Chromosome. For the Y-Chromosome it is a different story!!
Over time, mistakes have crept into the Y-Chromosome too. But every time a gene on the Y-Chromosome went bad, it basically disappeared and so the Y-Chromosome overall length began to shrink. Scientists theorise that the X and Y chromosomes started out with about the same amount of genes: about 1,098 genes. Today the Y-Chromosome has less than 90 genes. Will the Y-Chromosome disappear one day then?? Not really. The Y-Chromosome has been secretly creating backup copies of its most important genes. These are stored in the DNA as mirror images, or palindromes. Therefore maleness will not go extinct after all.
Above diagram shows a tiny Y-chromosome alongside two bigger X-chromosomes.
You can now work out how
X-Chromosome pairs up at the ends with Y-Chromosome.
Did You Know That?
The genes on the Y-Chromosome remain fast asleep after fertilisation. So when a sperm cell with a Y-Chromosome
version
fertilises the egg cell, only the X-Chromosome genes in the egg cell kicks-in first.
Therefore everyone is born (i.e. conceived) female!
Boffins say that it will be several weeks before the Y-Chromosome from the sperm cell wakes up from its
long hibernation
and begins to take over from the early start of the X-Chromosome. By the second month, the
Y-Chromosome genes from
the
sperm cell are now fully in charge of the development of the fertilised cell leading
to a male baby in 9 months
time. During the time only the X-Chromosome genes were in charge, it gave both male and female foetuses several similar human features, but once the Y-Chromosome
genes takes over the male foetus,
not all the human features trigged by the X-Chromosome genes are masked or deactivated. One such human feature is the nipples on the chest of males which has no useful function
but develops as the breasts in female foetuses (storing milk for future baby).
However because there is
no masking of the nipples on the male foetus that was triggered by X-Chromosome genes, when the Y-Chromosome genes takes charge, males still
retain the nipples on their chests!
Attention: Some Parts of the NRY (MSY) region Does Recombine!
In 2003,
medical researchers at the Howard Hughes Medical Institute of the Massachusetts Institute of Technology led by Dr Tomoko Kuroda-Kawaguchi and Dr Helen Skaletsky
confirmed a 1998 study which discovered that very small locations on the MSY region (that is the NRY parts) somehow DO recombine with the X-Chromosome! and
these locations must THUS be avoided when geneticists do thorough human ancestry
analysis on the Y-chromosome NRY region. Actually MSY is a good example of neologism,
because many geneticists around the world still use the term NRY, instead of the new term MSY.
Meanwhile to add to the confusion, there is a 3rd acronym that is used by other geneticists
instead of acronyms NRY or MSY, this non-recombining region of the Y-Chromosome is called: NRPY (for Non-Recombining Portion Y-Chromosome)! Talk about standardisation in genetics!
The Age of Y-Chromosome Adam
Recall that Mitochondrial Eve traces back to 200,000 years ago. The original male equivalent of
Mitochondrial Eve is called Y-Chromosome Adam. From DNA molecular clock measurements, geneticists estimated that on average, Y-Chromosome Adam is originally thought to
trace back to 142,000 years ago. There was thus a great mystery as to why there is a big age
difference between the two. However all that changed in 2014. See updated data below.
NEW UPDATED DATA
A scientific report in the European Journal of Human Genetics, (22 January 2014) has announced that
Y-Chromosome Adam actually dates back to 208,300 years ago. So both Mitochondrial Eve and Y-Chromosome Adam
are now roughly within the same timeframe of 200,000 years ago! Y-Chromosome Adam was not the first man, or the only man, from his time to contribute to modern human DNA. It is just that, by chance, his Y chromosome was the only one to survive until today.
Source:
Scientists say Y-Chromosome Adam is much older than previously thought
The Amazing Mystery of Mr Albert Perry's 338,000 year old Y-Chromosome DNA
Even though the Khoisan people of the Kalahari Desert have the oldest MtDNA lineage (i.e. L0 MtDNA haplogroup) dating at least
185,000 years old, the Kalahari Desert is not the origin of 200,000 year old Mitochondrial Eve, geneticists say she originated somewhere in Ethiopia or Kenya.
Meanwhile the Kalahari Desert is also not the origin of 208,300 year old Y-Chromosome Adam either.
Somewhere in western Cameroon's huge remote rainforest are the ancient Mbo ethnic groups and Bangwa ethnic groups who both have
the oldest human Y-Chromosome DNA lineages and are the best examples of hunter-gatherers still around in Africa, aside from the Khoisan in the Kalahari Desert.
The Mbo in particular carry the very ancient 338,000 year old A00 Y-Chromosome DNA haplogroup.
Meanwhile the Bakola ethnic groups of south western Cameroon carry the ancient 190,000 year old A0 Y-Chromosome DNA haplogroup.
These two genetic markers are thus much OLDER than the L0 MtDNA marker (185,000 years old) of the
Khoisan people of the Kalahari Desert, I have previously discussed.
This part of Cameroon now looks more likely as the origin of
Y-Chromosome Adam who is represented by (the new A00 Y-Chromosome DNA haplogroup). However there is a problem: as will be explained
later on below, the actual age of Y-Chromosome Adam is very much much older than the estimated age of 208,300 years old made made in 2014.
The proof of the possible discovery of the location of Y-Chromosome Adam, was in part due the mystery of an unidentified and very ancient Y-Chromosome DNA marker
found in an African-American individual named Mr Albert Perry in 2013 in the U.S. When his family members out of curiosity first submitted his Y-Chromosome DNA for ancestry tests it came back negative:
experts said his DNA did not seem to belong to any human Y-Chromosome DNA haplogroup in their database. When more detailed DNA tests were taken, the reasons why suddenly became clear: it turned out that Albert Perry's Y-Chromosome
DNA marker was far too ancient to be in their DNA database. A more thorough search, in a much larger database with more worldwide coverage going back further in time was then carried out, and subsequent analysis by
Dr Fernando Méndez et al, showed that
in fact Albert Perry's Y-Chromosome
DNA was so similar to the one found among the remote Mbo / Bangwa people in western Cameroon. This was a shock discovery: previously geneticists did not believe that
the A00 Y-Chromosome DNA haplogroup existed anywhere outside Cameroon.
It is possible that Albert Perry's ancestors came from Cameroon during the Slave Trade era (1650-1860),
along side hundreds of other captives, but as it turned out
Albert Perry's ancestors were the only ones today still retaining the A00 Y-Chromosome DNA haplogroup in the U.S.
It was further testing of the A00 Y-Chromosome DNA haplogroup in the Mbo / Bangwa people and the A0 Y-Chromosome DNA haplogroups in the Bakola people that
showed that they were both very much older that previously thought as well.
Since Y-Chromosome Adam dates back to 208,300 years ago, Albert Perry, and the Mbo / Bangwa ethnic groups with the same distinct A00 Y chromosome, actually are not descendants of
Y-Chromosome Adam, their origins simply push the dawn of humanity back from 208,300 years ago to 338,000 years ago.
You can read about Dr Fernando Méndez and Professor MF Hammer et al ground-breaking research work that confirmed the very ancient and new A00 Y-Chromosome DNA haplogroup below:
Fernando L. Méndez et al., An African American Paternal Lineage Adds an Extremely
Ancient Root to the Human Y Chromosome Phylogenetic Tree. American Journal of Human Genetics, vol 92, 3:454-459, 7 March 2013.
LINK:
An African American Paternal Lineage Adds an Extremely
Ancient Root to the Human Y Chromosome Phylogenetic Tree
American Journal of Human Genetics, vol 92, 3:454-459, 7 March 2013..
The Important Implications of Albert Perry's Ancient Y-Chromosome DNA
The correct dating of the A00 Y-Chromosome DNA haplogroup and the A0 Y-Chromosome DNA haplogroups by Dr Fernando Méndez and Professor MF Hammer raises a lot of questions. It raises more questions than answers. Thorough analysis of the A00 Y-Chromosome DNA haplogroup, shows that it dates back to 338,000 years ago. But both the oldest anatomically modern humans
and the accepted accurate dating of the Mitochondrial Eve L haplogroup, show that modern humans only came into existence 200,000 years ago! What is going on here? Why inconsistent dating?
It appears that human A00 Y-Chromosome DNA haplogroup came into existence when humans were at the Homo heidelbergensis in Africa and existed as
the Neanderthals in Europe and Western Asia and the Denisovans in Eastern Asia. The problem is Homo heidelbergensis was not yet anatomically modern human!!
There is one possible explanation among others:
Just after 200,000 years ago, a group of anatomically modern humans i.e.
archaic Homo sapiens had a chance
encounter with a group of surviving Homo heidelbergensis humans (whose normal ancestry went back 338,000 years ago).
This is possible because Homo heidelbergensis did not instantly disappear when
anatomically modern humans evolved 200,000 years ago, instead Homo heidelbergensis
was gradually reduced in population numbers over thousands of years
competing unsuccessfully with anatomically modern human for resources such as food and caves for shelter. Soon Homo heidelbergensis became extinct.
However the chance encounter did not end there, some form of mating actually took place during the encounter.
This cross-species mating
took place only in Cameroon where the original ancestors of the Mbo people lived. The result was hybrid or introgression: offspring containing both Homo heidelbergensis genes
and anatomically modern human (archaic Homo sapiens) genes: Albert Perry's ancestral mother mated with a male Homo heidelbergensis and the Y chromosome DNA
has passed down the male line to Albert Perry's ancestors! Over time, thousands of year later, natural selection allowed only the
modern Mbo people of Cameroon (and some nearby neighbours such as the Bangwa people and some ethnic groups now in places near the border with Cameroon and Nigeria) to retain some very ancient DNA of Homo heidelbergensis in their genome.
The mention of Nigeria brings up an earlier discovery: in 1971 by a team lead by Dr Thorstan Shaw
of the University of Ibadan made an astonishing discovery. A few hundred miles from the Cameroon border Thorstan Shaw
discovered the Iwo Eleru rock shelter in Nigeria, where excavated ancient human remains suggested that
an unknown cousin human species was still living there as recently as 15,000 years ago. In 2011 using advanced DNA techniques, this
unknown cousin human species was theorised to be most probably a
human hybrid (offspring containing both Homo heidelbergensis genes
and anatomically modern human (archaic Homo sapiens) genes). Today we can say with certainty
that the people living at Iwo Eleru rock shelter 15,000 years ago
carried the ancient A00 haplogroup.
Earlier on in Section C, I mentioned the Florisbad Fossils, discovered in South Africa.
In 1932, near the city of Bloemfontein, South Africa, zoology
Professor T. F. Dreyer stumbled upon the remains of so-called Florisbad fossils, which was later dated as circa 259,000 years old.
There was a problem with this fossil that puzzled other scientists: the Florisbad fossils were definitely not anatomically modern human
(which date from 200,000 years ago), because they
lacked the several prominent features associated with anatomically modern humans.
Even more surprising was the fact that the fossils did not seem to have the prominent features of Homo heidelbergensis either,
the ancestor of anatomically modern humans before 259,000 years ago, and also the last common ancestor of modern humans, Denisovans and Neanderthals.
So scientists gave the mysterious Florisbad fossils a new species name: Homo helmei.
Scientists today conclude that Florisbad fossils existed when Homo heidelbergensis was slowly evolving into anatomically modern humans,
hence Florisbad fossils had features that were in transition between Homo heidelbergensis and anatomically modern humans.
In other words Florisbad fossils are an intermediate form between Homo heidelbergensis and Homo sapiens.
Homo helmei is one of many human species that has failed to gain widespread recognition.
Textbooks tend to either mention it only in passing, or not at all! Homo helmei is discussed in Stephen Oppenheimer's
popular book The Real Eve, Dr Oppenheimer contends that Homo helmei may be a direct ancestor of Homo sapiens.
Cross-species mating of homo species (or introgression) should not come as a surprise.
Around the time Homo heidelbergensis existed in Africa 338,000 years ago, the Neanderthals were in
Europe and Western Asia and the
Denisovans were in Eastern Asia. When Homo sapiens moved into Europe, e.g. as the
Cro-Magnons (45,000 years ago) and Asia (70,000 years ago), respectively they encountered the
Neanderthals and the Denisovans. They went on to gradually drive both the Neanderthals and the Denisovans into
extinction, but not before some form of interbreeding (cross-species mating) took place.
Today 6% of Melanesians and 2% of Europeans and Western Asians have respectively Denisovan and
Neanderthal genes in their genome.
This is the closest possible explanation for the very ancient age of the human
A00 Y-Chromosome DNA haplogroup (338,000 years old). Since Y-Chromosome Adam dates back to 208,300 years ago, Albert Perry, and the Mbo / Bangwa ethnic groups with the same distinct A00 Y chromosome, actually are not descendants of
Y-Chromosome Adam, their origins simply push the dawn of humanity back from 208,300 years ago to 338,000 years ago.
The second Y-Chromosome DNA genetic marker map shown below in this ebook, does
show the locations of both the A00 Y-Chromosome DNA haplogroup of the Mbo people, and the A0 Y-Chromosome DNA haplogroups belonging to
Bakola people. Look for the big yellow star in the map,
shown where West Africa meets Central Africa, that is Cameroon!
You can read about the amazing discovery 2013 of the mystery of the Albert Perry's very ancient DNA and the revision of the oldest Y-Chromosome
DNA by doing a quick Google Search with the terms: "Albert Perry Y Chromosome DNA"
Three sources are shown below to whet your appetite:
Source 1:
The Family Tree That Rewrote Human History
The Daily Mail (popular U.K. tabloid newspaper), 7th March 2013.
Source 2:
The extremely ancient chromosome that isn’t: a forensic bioinformatic investigation of Albert Perry’s X-degenerate portion of the Y chromosome.
European Journal of Human Genetics, vol 22, 1111-1116, September 2014.
Source 3:
The father of all men is 340,000 years old.
New Scientist, March 2013 issue.
What Type of Markers (Mutations in Haplogroups) Are Used in Y-Chromosome Ancestry Projects?
Recall that SNPs are used as markers to differentiate the different 36 haplogroups in MtDNA. About
20 different Y-Chromosome DNA markers have so far been allocated to cover the entire worldwide male population.
The major clades are: A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S and T.
They are identified by Binary Markers, which are of course major groups of SNPs!
Still as Y-Chromosome DNA markers are much bigger and complex than MtDNA, geneticists can also use STR or Short Tandem Repeats on Y-Chromosome DNA
as markers, instead of SNPs.
Short Tandem Repeats are discussed in detail later on after this Y-Chromosome DNA tutorial.
The Molecular Clock and Mutation Rates for Y-Chromosome DNA
Earlier on in this ebook I noted that: The Molecular Clock for MtDNA reveals that human MtDNA is 200,000 years old and the Mutation Rate is
calculated as one major mutation (major SNPs) every 6,000 to 12,000 years.
In others words: The MtDNA as a genetic marker is passed from
generation to generation almost unchanged by mutation for at least 12,000-15,000 years.
It was mentioned earlier on in this ebook that the Khoisan people of the Kalahari Desert and the Mbo people in western Cameroon
both have the oldest ancestry in the world, because they have the most mutations in their
MtDNA and Y-Chromosome DNA respectively.
Meanwhile the Molecular Clock measurements for human Y-Chromosome DNA indicate that it is 208,300 years old.
And the Mutation Rate is calculated as one mutation every 2,000-5,000 years.
This means that in others words: The Y-Chromosome DNA as a genetic marker is passed
from generation to generation almost unchanged by mutation for at least 2,000-5,000 years.
Earlier in this ebook I defined both mutation rates and molecular clock: A mutation rate is the number of mutations which occur on average per generation.
Mutation rates are determined by comparing the DNA of offspring to parents, and counting up the differences.
Molecular Clock is the concept of measuring the time when lineages of humans
diverged, based on the assumption that mutations occur at a steady rate over time.
Homoplasy and DNA Molecular Clocks
Sometimes while analysing MtDNA or Y-DNA data carefully in a lab, following extraction and sequencing and
trying to come up with
reliable and accurate
molecular clock calculations and mutation rate calculations, to construct reliable phylogenetic trees, the results can vary greatly
in different labs doing the same research work. Confusing results
do not may mean errors were made in the lab. Instead Homoplasy has crept in!
Genetic marker duplication from independent identical mutations is called
homoplasy. These duplications cause confusing dates in phylogenetic trees, since molecular clocks
depend greatly on accurate mutation rate calculations. Mitochondrial DNA has much higher
levels of homoplasy owing to its more frequent recurring mutations compared to Y-Chromsome DNA.
While Mitochondrial DNA has a high level of homoplasy approaching over 30%, Y-Chromsome DNA has a low level of
homoplasy of about 2%. The low homoplasy in the Y-chromosome phylogenetic trees implied that it
contained more accurate phylogenetic
information than mitochondrial DNA phylogenetic tree. Recall that in 1987, research work of
the University of Berkeley team led by Professor Alan Wilson, had created a
phylogenetic tree, with DNA molecular clocks measurements putting the date of Mitochondrial Eve
as 200,000 years ago. But when other scientists independently tried to recreate the research work months later
some got dates that were much lower than 200,000 years ago. When scientists discovered homoplasy was rife in MtDNA,
they discovered that homoplasy was the chief cause for the other confusing dates. So taking into account
30% homoplasy in MtDNA, the date of Mitochondrial Eve as 200,000 years ago is spot on:
Anatomically modern man appeared 200,000 years ago. The same argument applies to calculating the
exact date for Y-Chromosome Adam (142,000 years ago, revised as 208,300 years ago).
Worldwide Human Y-Chromosome DNA Genetic Maps
Three Y-Chromosome DNA Genetic Maps are now shown below. Each one explains Y-Chromosome DNA markers in a different way.
WORLDWIDE GENETIC MAP (Y-CHROMOSOME DNA) OF HUMAN MIGRATIONS OUT OF AFRICA, 70,000 years ago.
Map 1
You can read more about these mutations and haplogroups in the 2018 book, Tracing Our Genetic Mutations: From Me to You, by Richard Donovan Gover
After looking at the Y-Chromosome DNA migration map above, take a good look below of a diagram on
Y-Chromosome DNA markers found in Native American Indians in the U.S.
Copyright © James Shreeve, Biological Anthropology: The Greatest Journey, 2006. National Geographic Learning Reader.
The above two diagram simplifies how the two widely used genetic markers (MtDNA and Y-Chromosome DNA) tell us about our ancestry.
It confirms that the oldest Y-Chromosome DNA marker found outside Africa is the M168 marker, which descended from the African M94 marker.
The above two diagrams are a good examples of DNA profiling showing migrations routes.
In both diagrams above for example, we see that the order in which the markers appear also
show us the exact route taken by the ancestors of Native Americans from Africa to the Americas.
M91 Africa (90,000 years ago) M168 East Africa (50,000 to 70,000 years ago)
M89 Middle East (50,000 years ago) M9 Central Asia (40,000 years ago) M45 Central Asia (30,000 years ago)
M242 East Asia (28,000 years ago) M3 the Bering Straits en-route to North America, the final destination (10,000 to 20,000 years ago).
Interpretation of the Y-Chromosome DNA haplogroups Genetic Map
African Y-Chromosome DNA Mutations
By the way the orange coloured routes in the above map are the MtDNA markers discussed earlier on. From the map we see how the original African M94 (not shown in map above), M60 and M91 Y-Chromosome DNA mutations
(in blue colour) which all descend from Y-Chromosome Adam
mutated over several thousands of years first into the East African M168 Y-Chromosome DNA mutation (the equivalent of the L3 MtDNA marker).
All male humans today who ancestry is outside Africa have the M168 marker in their genome. It is sometimes called Eurasian Adam
the common ancestor of everyone living today outside of Africa. Then circa 75,000 years ago M168 mutated into the Middle Eastern M89 Y-Chromosome DNA genetic mutation found
exclusively outside Africa (it is the equivalent of the M and N Mitochondrial DNA markers discussed previously). The M89, a mutation is found in 90 to 95 percent of all non-Africans. The orange colours in the map above actually represent MtDNA markers and migration routes
for comparing with Y-chromosome mutation and migration routes.
During DNA profiling of a Native American Indian male in the US and Canada, a male Asian student
in China, and a male European
doctor in Greece using Y-Chromosome DNA, the first major genetic marker to show up is the African M168 mutation.
What is the YAP Mutation?
If you look on the map above showing Africa, in the centre you see a Y-DNA mutation marker called YAP. What is this? On the long arm of the human Y-Chromosome is the unique ALU family of repeated DNA referred to as Y Chromosome ALU Polymorphism or just YAP. This marker can easily be identified in DNA analysis so is one of the easiest to trace and identify during DNA profiling.
What makes YAP fascinating is that insertion of sequences on YAP is a very good useful marker.
Recall earlier on in the early part of this genetics tutorial, I explained that mutations in Nuclear DNA are easily located by looking for what geneticists term Repeats AND Deletions.
Geneticists call insertions (REPEATS) into or deletions of DNA INDELS.
There are just over 26,000 indels in the human genome! (i.e. the 3 billion nucleotide base pairs in nuclear DNA have over 26,000 indels).
One insertion particularly useful in population studies is the YAP. ALU is what geneticists call a sequence of approximately
300 nucleotide base pairs which has inserted itself into a particular region of Y-chromosome DNA. There have been some half a
million ALU insertions in human DNA from evolution going back over a million years; and YAP is one of the more recent.
I discuss more about the remarkable YAP mutation later on in this eBook.
What is the LLY22 Mutation?
If you look on the map above showing north western Asia, in the centre you see a Y-DNA mutation marker called LLY22. What is this?
LLY22 is the defining mutation marker for haplogroup N (shown in the next Y-Chromosome DNA Genetic Map). It is a unique
marker found in northern parts of Scandinavia particularly northern Finland
as well as Siberia east of the Altai Mountains, and in northeastern Europe (Uralic-speaking populations). Many Russians also have the LLY22 marker
as well as the reindeer-herding Saami people of northern Scandinavia and Russia. It is a young marker, only emerging in the last 10,000 years.
It is unique from the fact that the tens of millions of people today who carry the marker all descend from just one small group of men (15 or less) who traveled north through the Pamir Knot region
10,000 years ago. Three south central Asia mountain ranges meet in a region known as the "Pamir Knot," located in present-day Tajikistan (these are the Hindu Kush, the Tian Shan, and the Himalayas).
The three mountain ranges caused the ancestors of the LLY22 to split into two groups, some moved north into Central Asia and Siberia,
others moved south into what is now Pakistan and the Indian subcontinent. Those that moved into Siberia, northern Scandinavia and Russia were carried there by the small group of men
bearing the LLY22 Mutation (probably all members of the same family).
Asian Y-Chromosome DNA Mutations
The M89 mutation further mutated into several branches. For instance ancient people migrating towards Asia carried
mutations in the Y-Chromosome DNA mutations such as M9 (Iran and Southern Central Asia), M201 (Israel, Syria, Iraq, etc), M45 (central Asia such as Uzbekistan etc), M20 and M69 (Indian Sub-continent as well as Sri Lanka), M52 (mostly Indian Sub-continent, this marker is not shown on map above),
M175 and M122 (East Asians e.g. Malaysia, Vietnam, China, Japan (excluding the Ainu or Aynu people), Thailand, The Philippines etc) and finally M130 (the M130 ended up as far as Australia, passing through southern India) .
The M130 mutation is the first and thus oldest Y-Chromosome DNA genetic marker, outside of Africa.
It is roughly 70,000 to 65,000 years old. On the genetic map above,
one can see that M130 marker travels from Africa to Yemen, onto southern India, then through
Malaysia/Indonesia, before reaching Australia. This route supports the fact that
all of today's original or first indigenous Asian people, such as:
the Sentinelese (Andaman Islands, 55,000 years ago); Orang asli and Semang (Malaysia 50,000 years ago); Niah caves fossils (Malaysia, 46,000 years ago); the Maniq (Thailand, 44,000 years ago); and finally the Aeta or Ayta (the Philippines, 42,000 years ago
) and the Aboriginals (Australia, 48,000 years), all carry this very ancient genetic marker, M130.
In other words, for instance the ancestors of the Aboriginals in Australia came from
a group of ancient people in southern India who migrated eastwards, from 55,000 years ago.
European Y-Chromosome DNA Mutations
Meanwhile ancient people migrating towards Europe carried mutations in the Y-Chromosome DNA such as
M269, M343, M45, M17 and M173, they were the most common migration routes into Europe from Asia. N.B. the M269 mutation
is not shown in the genetic map above. Molecular geneticists tell us that the M173 mutation is among the oldest.
Men who carry the M173 mutation may have been the first modern humans to enter Europe
45,000 years ago (as the Cro-Magnons), founding what archaeologists call the Aurignacian culture. Bearers of
M170 are thought to have brought the Gravettian culture that succeeded the Aurignacian
28,000 years ago.
Americas Y-Chromosome DNA Mutations
Ancient people migrating towards the Americas (e.g. today's Native Americans, and other indigenous groups in Central and South America) carried Asian mutations
in the Y-Chromosome DNA such as the M3 and M130. Apart from the M130 mutation, another significant marker that made its way to the Americas from Asia, was the
M242 mutation.
Here is another example of how to interpret the above interesting Y-Chromosome DNA genetic map. If we use DNA profiling to show migrations routes to Spain, in Europe,
we can use the following sequence of Y-Chromosome DNA markers:
M91 Africa of specific haplogroup BT, (90,000 years ago) M168 East Africa (50,000 to 70,000 years ago)
M89 Middle East (50,000 years ago) M9 and M45 Central Asia (48,000 years ago)
M173 Eastern Europe (45,000 years ago) M343
Western Europe, then onto Spain, the final destination (28,000 years ago).
Here is one more example of how to interpret the above interesting Y-Chromosome DNA genetic map.
Copyright © Steve Jurvetson·
In this diagram a male volunteer from Estonia,
submitted his Y-DNA which showed that he has the L22Y mutation, derived from the M9 mutation (south west Asia such as Iran), derived from the M89 Mutation (the Middle East)
which derived from the M168 mutation (Africa). It places the donor in Haplogroup N (see genetic map below for location of N haplogroups and its sub-haplogroups such as N1a, N1b and N1c). Since this is a popular science text, I will not go into complex
details of how the exact
DNA analysis was undertaken. More experienced readers are referred to use advanced academic texts such as
Human Evolutionary Genetics by Mark Jobling, Edward Hollox et al. ISBN-13: 978-0815341482.
The Y-Chromosome DNA mutation map above is based on the well researched late 1990s worldwide Y-Chromosome DNA ancestry research lead by
Professor Spencer Wells (Cornell University), which became the basis for his fabulous book: The Journey of Man: A Genetic Odyssey, published by Penguin in 2003. The research project on Y-Chromosome DNA markers by Professor Spencer builds on earlier research projects, most notably Dr Peter A. Underhill (Stanford University) who famously discovered the M168 mutation, the
(equivalent of the L3 MtDNA marker discovered by geneticists most notably Professor Alan Wilson) and
Professor Luigi Luca Cavalli-Sforza.
The Journey of Man: A Genetic Odyssey was also a 2-hour popular 2004 National Geographic TV documentary, based on
Professor Spencer Wells research project. Following up on his research work is
the Genographic Project, launched on 13 April 2005,
by the National Geographic Society and IBM. It is a multi-year genetic anthropology study that aims to map
historical human migration patterns by collecting and analysing DNA samples (mostly Y-Chromosome DNA samples) from thousands of people (males)
from around the world who voluntary give Y-DNA samples.
The Journey of Man: A Genetic Odyssey 2003 National Geographic TV documentary
A More Complex Y-Chromosome DNA Genetic Map
Whereas the letter M is the most common alphabet used in the above easy-to-understand and simple Y-Chromosome DNA genetic map above (Map 1),
most geneticists also use a more complex map. This time this genetic map
only shows major haplogroups and sub-haplogroups and does not show the defining mutations associated with each of the haplogroups and sub-haplogroups, as we saw in Map 1.
The Y-Chromosome DNA haplogroups in the second world genetic map below comprise:
A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S and T. That is 20 Y-Chromosome DNA haplogroups. Clearly this more complex
naming convention can cause confusion for non-geneticists
when trying to compare this more complex genetic map with the worldwide MtDNA genetic map discussed earlier on, since
many of the letters
found in the complex method Y-Chromosome DNA genetic map below, are also used in
universally agreed MtDNA genetic map shown earlier on.
Below shows how the more comprehensive and complex Y-Chromosome DNA genetic map looks like:
.png "the more complex human Y Chromosome DNA marker map")
WORLDWIDE GENETIC MAP (Y-CHROMOSOME DNA) OF HUMAN MIGRATIONS OUT OF AFRICA, 70,000 years ago.
Map 2
N.B. Map 2 (very recent and dated 2014) does not actually just show the 20 Y-Chromosome DNA haplogroups, because it includes dozens of smaller haplogroups or sub-haplogroups as well. The third Y-Chromosome DNA genetic map (Map 3) below does show the 20 Y-Chromosome DNA haplogroups.
When you compare the second and third Y-Chromosome DNA genetic maps, you will see a clear similarity between the two.
Defining Mutations (SNPs) Associated with the Y-Chromosome DNA Haplogroups
We now use the information in Map 1 and Map 2 Y-Chromosome genetic maps, to illustrate some of the defining SNP mutations associated with the Y-Chromosome DNA haplogroups:
i) In Map 1 we see that the African M94, M60 and M91 mutations (the equivalent the L0, L1 and L2 MtDNA haplogroups etc) are represented by the A00, A0, A1, A2 and A3 haplogroups in Map 2.
Thus the A haplogroup belongs to Y-Chromosome DNA Adam, the male equivalent of the L MtDNA haplogroup of
Mitochondrial Eve, discussed earlier on.
Therefore, while the Khoisan people of the Kalahari Desert have the ancient female L0 MtDNA genetic marker, the male
equivalent is the A00 Y-Chromosome DNA genetic marker found among ethnic groups of a western Cameroon village known as the Mbo.
Have a good look at the complex Y-Chromosome DNA genetic map above: there is a huge yellow star. The location
of this star (western Cameroon) marks the exact spot were geneticists now say Y-Chromosome Adam originated. The Khoisan people of the Kalahari Desert,
who as earlier indicated have the oldest MtDNA haplogroup (the L0 haplogroup) have been found to carry the 3rd oldest African Y-Chromosome DNA haplogroups, the A2 and A3 haplogroups.
The Bakola ethnic groups of south western Cameroon carry 2nd oldest African Y-Chromosome DNA haplogroups at 190,000 year old: the A0 Y-Chromosome DNA haplogroup.
To summarise, the A00 Y-Chromosome DNA haplogroup
is the oldest possible modern human Y-Chromosome DNA haplogroup, dating 208,300 years ago (revised as 338,000 years ago). The L MtDNA haplogroup of
Mitochondrial Eve dates which dates back 200,000 years ago (is the oldest possible modern human MtDNA haplogroup).
Notice that the above Y-Chromosome DNA map also shows a few other haplogroups within Africa, other than the A haplogroup.
For instance we find the B haplogroup comprising B1 and B2 (defining SNP mutations = M112, M181,
not shown in the first genetic map); the E haplogroup comprising sub-haplogroups such as E1b1a, E1b1b1, E1b1b2 etc,
(defining SNP mutations = M96, M2, M35, all shown in the first Y-Chromosome DNA genetic map except the M2 mutation).
ii) In the first Y-Chromosome DNA genetic map (Map 1) we see that the Asian M130 mutation in Australia for the Australia Aborigines
(the equivalent of the Asian M MtDNA haplogroup discussed earlier on) is represented by C4 sub-haplogroup in the second Y-Chromosome DNA map Map 2.
iii) In the first Y-Chromosome DNA genetic map (Map 1) we see that the European (Western part) M269, M173, P25 and M343 mutations are represented by
R1b haplogroups in the second Y-Chromosome DNA
genetic map (Map 2). Recall that A defining mutation is where we find the presence of the single nucleotide polymorphism or SNP marker on
Y-Chromosome DNA. Therefore, the Haplogroup R1b is identified by the presence of the single-nucleotide polymorphism (SNP) mutation M343.
The ancestors of the Celts whose male descendants today are found in places like Cornwall,
Wales and Brittany
were the original R1b mutation carriers. The R1b is also present at lower frequencies
throughout Eastern Europe, but the R1a is more prevalent in Eastern Europe.
The major defining SNP mutations of R1a haplogroup is the M17 mutation. R1a is also present in northern Germany.
When the Anglo-Saxons, Angles and Jutes migrated to Britain, they brought along the R1a mutation.
The R1b haplogroup is also found in lower frequencies in
Western Asia, Central Asia, and parts of North Africa, South Asia, and Siberia.
Due to European emigration R1b also reaches high frequencies in the Americas,
Brazil, Argentina, Australia and New Zealand. Also shown is the above genetic map is the I1 haplogroup, very common in Scandinavia and northern Europe.
iv) The African M168 mutation (the equivalent of the L3 MtDNA marker) are represented by CT haplogroup.
CT actually means haplogroups C through T. This is Eurasian Adam, the father of all males who live outside Africa today.
v) The Middle East M89 mutation (the equivalent of the N MtDNA marker) are represented by F haplogroup.
vi) The Asian M175 and M122 mutations are represented by O haplogroup and its variants.
vii) The Asian M242 and M3 mutation, which reached the Americas via the Bering Straits are represented by Q haplogroup and its variants.
viii) The Asian M9 mutation represented by K haplogroup.
The majority of geneticists are happy to use both Y-Chromosome
DNA genetic maps above, but most will use the second one.
But the second complex human Y-Chromosome DNA genetic map is essentially the same thing as the first human Y-Chromosome DNA genetic map shown above previously,
just more accurate and more comprehensive.
Recall that I noted that the in the first Y-Chromosome DNA marker genetic map
(i.e. Map 1) mostly shows DEFINING MUTATIONS, hence it uses the letter M through out. For instance consider this statement: one of the defining "mutations" in the Australian Aborigine C4 "marker" is the Australian Aborigine M130 mutation AND
one of the defining "mutations" in the European R1b "haplogroup" is the European M343 mutation.
Put in another way: Haplogroup R1b is identified by the presence of the single-nucleotide polymorphism (SNP) mutation M343. OR
Haplogroup R1b is identified by the presence M343 defining SNP mutation.
A closer look at both
Y-Chromosome DNA genetic maps above clearly show the relationship between Y-Chromosome DNA sub-haplogroup C4 (of the C haplogroup) and Y-Chromosome DNA mutation M130,
and Y-Chromosome DNA haplogroup R1b and Y-Chromosome DNA mutation M343.
Both two
Y-Chromosome DNA genetic maps clearly compliment each other.
Another example: one of the defining SNP mutation in the African CT "haplogroup" is the African M168 mutation.
CT actually means haplogroups C through T. This is Eurasian Adam, the father of all males who live outside Africa today.
Another example: one of the defining SNP mutation in the Asian Q "haplogroup" is the Asian M242 mutation.
Another example: one of the defining SNP mutation in the Australian Aboriginals C "haplogroup" (i.e. C4 sub-haplogroup) is the Asian M130 mutation.
Put in another way, within the Q Y-Chromosome DNA haplogroup, is the Y-Chromosome DNA M242 mutation.
More examples: within the O Y-Chromosome DNA haplogroup, is the Y-Chromosome DNA M175 and M122 mutations.
You can read more about these mutations and haplogroups in the 2018 book, Tracing Our Genetic Mutations: From Me to You, by Richard Donovan Gover.
When you continue to compare both Y-Chromosome DNA genetic maps in detail, you will soon notice that the first Y-Chromosome DNA genetic maps IS actually missing
a lot more defining mutation (markers).
Separating the
word "marker" from the word "mutation" is evident in the statement above, even though they can
both theoretically mean the same thing! markers and mutations occur within a haplogroup
WORLDWIDE HUMAN Y-CHROMOSOME DNA PHYLOGENETIC TREE
Showing some of the Defining Mutations (SNPs) Associated with the 20 Y-Chromosome Major DNA Haplogroups or clades.
We now use the information from Map 1 and Map 2 to illustrate much more of the defining mutations associated with the Y-Chromosome DNA haplogroups:
The above diagram is a Y-Chromosome DNA Phylogenetic tree, showing the relationship between the Y-Chromosome DNA SNP mutations shown in the first genetic map previously and the
Y-Chromosome DNA haplogroups shown in the second map genetic Map. However this is an incomplete picture as the
very first genetic map above (Map 1 showing defining mutations) and
the Y-DNA Phylogenetic Tree diagram above both show less than 50 defining SNP mutations. However
the most complete Y-Chromosome DNA genetic maps in 2016 show over 150 possible Y-Chromosome defining
DNA mutations spread over 20 major Y-Chromosome DNA haplogroups.
This is maintained by the International Society of Genetic Genealogy.
More details given below shortly.
N.B. I have also included a more detailed
Y-Chromosome DNA Phylogenetic tree near the end of this genetics tutorial,
showing over 120 defining SNP mutations.
I have kept both kept both Y-DNA phylogenetic trees diagrams separate, for the sake of simplicity, as the second phylogenetic tree is more complex.
When you compare the first two Y-Chromosome genetic maps (Map 1 and Map 2) and this Y-DNA phylogenetic tree diagram above, you see that all three now give a very clearer picture of human Y-DNA haplogroups and the defining mutations found within each haplogroup.
For example from the genetic tree diagram above we see that the African M91 mutation of specific haplogroup BT, is within the African A haplogroup; The European M173 mutation is
within the European R1b haplogroup (part of the major R haplogroup). Likewise
the northern Asian M242 and M3 mutations (which travelled to the Americas via the Bering Straits), is within the Asian Q haplogroup.
The Asian M9 mutation is within the K haplogroup, while the Asian M175 mutation is within the O haplogroup.
Although most geneticists agree
that there are about 18 major Y-Chromosome DNA haplogroups are located around the world viz: A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, and R. Some genetics textbooks also mention two further rare Y-Chromosome DNA haplogroups, viz: the haplogroup S (with the single defining M230 mutation, and found only in Papua New Guinea and some parts of Melanesia)
and the elusive and intriguing haplogroup T (with the single defining M70 mutation, it is found in very
low frequencies in southern Europe, North and East Africa and the Middle East) as the tree
above shows. Giving a grand total of 20 major Y-Chromosome DNA haplogroups.
Both the S and T haplogroups are recent additions, haplogroups S and T were formerly part of haplogroup K.
In detail: MtDNA and Y-DNA Haplogroups This link provides a detailed explanation of the two
types of haplogroups used today to study human ancestry and population genetics.
Finally a 3rd Y-Chromosome DNA genetic map (Pre-Colonial)
By adding Pre-Colonial, this means genetic map is based on indigenous populations worldwide, before the massive migrations of millions of
people all over the world
to other continents from the 1500s till today.
.png "another more complex human Y-Chromosome DNA marker map")
WORLDWIDE GENETIC MAP (Y-CHROMOSOME DNA) OF HUMAN MIGRATIONS OUT OF AFRICA, 70,000 years ago.
Map 3
This genetic map DOES show us were all the 20 major
Y-Chromosome DNA haplogroups are located around the world viz: A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S, and T.
Some genetics textbooks agree that the last two Y-Chromosome
DNA haplogroups are rare, viz: S and T haplogroups, which are both not shown
in the above genetic map. Both the S and T haplogroups are
recent additions. Haplogroups S and T were formerly part of haplogroup K.
The numbers 1 to 48 in the map above simply represent a selection of male ethnic groups in the area covered by
the haplogroup, making it easy to make sense of the map.
For instance 1 = Khoisan people of the Kalahari Desert (2nd oldest ethnic group in Africa and the World);
2 = Central Africans;
3 = West Africans;
6 = Berber people of North Africa such as in Morocco and Algeria (original inhabitants of much of North Africa before the arrivals of the Arabs);
8 = Ethiopians in East Africa;
9 = Basques people in southern Spain (oldest ancient ethnic group in Europe);
10 = Greeks;
11 = Majority of Western Europeans;
12 = Saami (Sami or Lapp) people of Finland;
13 = Russians;
20 = Finnish (the people of Finland and Hungary share a common ancestor);
25 = Eskimos of northern eastern Siberia;
14 = Lebanese;
15 = Iranians;
17 = Kazaks of central Asia;
18 = Punjabis of India;
26 = Mongolians;
28 = Han Chinese;
31 = Japanese (excluding descendants of the ancient The Ainu or the Aynu people and descendants of the ancient Jomon people);
32 = Koreans (North and South);
33 = Filipinos;
35 = Malays of Malaysia (excluding descendants of the ancient Semang and other indigenous ethnic groups);
34 = Javanese of Indonesia;
38 and 39 = Aborigines of Australia;
37 = Melanesians of Papua New Guinea (Papuan people);
36 = Amungme, Asmat, Bauzi, Dani, Kamoro, Kombai, Korowai, Mee, Sentani, Yali, and Yei indigenous
ethnic groups of Papua Province or Irian Jaya (part of Indonesia);
29 = Tibetans;
42 = Maori of New Zealand;
41 = Tahitians of French Polynesia;
43 and 44 = respectively Navajos and Cheyenne Native Americans in the U.S (mostly Arizona and New Mexico
(Navajos), and Montana and Oklahoma (Cheyenne);
45 = Mixtecs of Mexico;
46 = Amazon Rain Forrest ethnic groups of Brazil;
47 = Quechuan indigenous ethnic groups (Runakuna, Kichwas, and Ingas) of Guatemala, Peru and Bolivia, (also found in Chile, Colombia and to some extent in Argentina);
and finally 48 = Inuit of Greenland.
This 3rd Y-Chromosome-DNA genetic map (Map 3) is essentially the same as 2nd Y-Chromosome-DNA genetic map (Map 2),
ONLY that it does not show the smaller haplogroups (or sub-haplogroups).
In genetics, a sub-haplogroup is a subgroup of a haplogroup.
For instance in Map 3 we see that in Europe
just the R haplogroup is shown, instead of smaller sub-haplogroups like R1b.
The subclades of R1b sub-haplogroup include: R1b1, R1b1b1, R1b1b2 etc.
Likewise in Africa we just see the major A haplogroup instead of the smaller sub-haplogroups
such as A0, A00, A2, A3 etc. In Australia we see the C and K haplogroups instead of
sub-haplogroups like C4. It is easy to see that the vast majority of Native American men in North America have the
Q haplogroup in their Y-DNA, also seen in other indigenous populations in South America such as the Quechuan indigenous ethnic groups, also evident in
Map 2.
You can read more about these mutations and haplogroups in the 2018 book, Tracing Our Genetic Mutations: From Me to You, by Richard Donovan Gover
Brief Summary for All Three Genetic Maps and Y-DNA Phylogenetic Tree Showing the Haplogroups and Mutations of the Y-Chromosome DNA
Now we can summarise very briefly what all the diagrams above tell us:
First of all this one fact: out of the 20 major Y-DNA haplogroups, A, B, C, D, E, F, G,
H, I, J, K, L, M, N, O, P, Q, R, S, and T only A, B, and E haplogroups are all based in Africa (with the exception of E which is found outside Africa as well). The rest of the remaining haplogroups
are descendants of A, B, and E, and all based outside Africa, in Asia, Europe and the Americas.
Remember that a haplogroup is a population of individuals whom
share a unique set of genetic markers that were derived from a common ancestor.
All members of a haplogroup are descendants of a single man or woman that lived in the very very distant past.
Each MtDNA (maternal) and Y-DNA (paternal) haplogroup has a distinct set of SNP genetic markers or DEFINING MUTATIONS
that define, distinguish and separate the different MtDNA and Y-DNA haplogroups.
When geneticists want to refer to a particular Y-DNA haplogroup and its defining SNP mutation marker, they sometimes group them both together e.g.
CT-168 or CT(M168) refers to the M168 mutation of the CT haplogroup. G-201 or G(201)
refers to the M201 mutation of the G haplogroup, meanwhile Q-242 or Q(242)
refers to the M242 mutation of the Q haplogroup and so on.
1) Y-Chromosome DNA Haplogroups In Africa
In Sub-Saharan Africa, the three most common haplogroups (present in all four illustrations above)
are the very old A haplogroup (Major Defining Mutations= M94, M60 and (M91 of specific haplogroup BT in Africa); the E haplogroup
(Major Defining Mutations= M96, M2, M35), and the equally old B haplogroup (Major Defining Mutations= M118, M181). All three haplogroups
representing over 99% of the native population of Sub-Saharan Africa. North African population (before the Arab conquest) also
primariy belong to the
E haplogroup, but as the diagram below shows, the sub-haplogroup of North Africa is specifically E1b1b1, whereas the majority haplogroups of
West, East, Central, and South Africa are the E1b1a7a, E1b1a8 and E1b1a haplogroups. Due to the
arrival of Arabs in the 8th century AD muslim conquest of North Africa, the J1 subclade of the J haplogroup of the Middle East
such as Saudi Arabia, Iran, Iraq, Syria,
Lebanon, Jordan and Israel, is also found in North African populations today.
The A haplogroup is composed of smaller
haplogroups viz: A0, A00, A1, etc etc. Meanwhile the E haplogroup is composed of smaller
sub-haplogroups and subclades viz: E1b1a, E1b1b, E1b1b1, E1b1b2 etc. The B haplogroup is also composed of smaller sub-haplogroups such as
B1, B2, B2b, B2b1, etc.
The above diagram shows the where the majority Y-Chromosome DNA African haplogroups sub-haplogroups and subclades are located viz: A, B and E haplogroups.
About 96% of the entire African population today carries the E haplogroup.
From the above diagram we see that the two majority subclades of the E1b1 sub-haplogroup of the E haplogroup found in most sub-Saharan
Africa are the E1b1a7a and E1b1a8 subclades of the E1b1a sub-haplogroup mentioned above.
The other 4% of the modern African population today belong to
two very ancient and rare haplogroups: the A and B haplogroups. The A haplogroup is oldest possible haplogroup of humans today anywhere in the world
(over 300,000 years old for the A00 sub-haplogroup and 190,000 years old for the A0 sub-haplogroup). The sub-haplogroups of the A haplogroup
such as A00, A0, A1 (Mutation P305), and A1b (Mutation P108), A1b1 (Mutation L419/PF712) etc thus all belongs to the following ancient African ethnic groups: the Mbo, Bakola, Bangwa (Western Cameroon),
Kho and San or Khoisan (Kalahari Desert of Namibia, Botswana and South Africa). The full technical name of the A00 hapogroup is Mutation AF6/L1284.
The full technical name of the A0 hapogroup is Mutation A-L1085 or A0-T.
You can read more about these mutations and haplogroups in the 2018 book, Tracing Our Genetic Mutations: From Me to You, by Richard Donovan Gover
The other very ancient haplogroup, the B haplogroup belongs to the Mbuti and
Biaka Pygmy (Zaire and Central African Republic respectively) and Hadza & Sandawe (Tanzania), as well as some old Kenyan, Sudan (Dinka) and Ugandan ethnic groups,
all found in Central and East Africa. Kho and San in Namibia and South Africa and also carry the B haplogroup as well as the A haplogroup.
The ancestry of the Mbo, Bakola, Bangwa, Kho, San, Mbuti and Biaka Pygmy, Sandawe, and Hadza ethnic
groups are the thus oldest in Africa and the entire world,
as all the ethnic groups carry either or both of the haplogroups A and B, the oldest haplogroups in the world. Two other common things about these
two sets of ancient ethnic groups is
that first of all, almost all of them speak an unusual type of very ancient language known as the Click Languages. Secondly they also have the oldest Mitochondrial DNA
haplogroups in the world: the L0 haplogroup (185,000 years old, for the Kho and San people or Khoisan) and L1 and L2 MtDNA haplogroup (150,000 years old,
for the Hadza, Bakola, Mbo and other ethnic groups mentioned above).
The Click Languages still continue to fascinate geneticists around the world. Among revealing studies was a research project in 2007 at the University of Maryland in the U.S., details below:
History of Click-Speaking Populations of Africa Inferred from MtDNA and Y Chromosome Genetic Variation
Molecular Biology and Evolution, Volume 24, Issue 10, 2180-2195, 2007.
All the A, B and E haplogroups and sub-haplogroups and defining mutations are
listed in the second detailed Y-Chromosome DNA Phylogenetic Tree diagram shown below (minus the A00 and A0).
Oldest Human Y-DNA Haplogroups
Y-Chromosome Adam represents the most recent common paternal ancestor of all living humans.
By definition, all modern human men fit into the 200,000 year old African Y-DNA Haplogroup known as the A Haplogroup.
Haplogroup A is then split into the two major haplogroups: 140,000 year old African B and 70,000 year old African CT, haplogroups.
CT actually means haplogroups C through T. This is Eurasian Adam, the father of all males who live outside Africa today.
It is from the Y-DNA Haplogroup known as CT, that the remaining Non-African (European and Asian) Y-DNA haplogroups.
are descended from.
The East African M168 mutation (tip: look at Y-Chromosome DNA defening mutation genetic map below), from which all the other non-African mutations below
descended from, is given its own Haplogroup known as the CT haplogroup for a very good reason: CT actually means haplogroups C through T. This is Eurasian Adam, the father of all males who live outside Africa today.
The M168 mutation of the CT haplogroup as mentioned above is about
70,000 years old. The other significant mutation in the ancient CT haplogroup is the M294 mutation.
Every single male outside Africa: Asia, Europe and the America, all have the M168 mutation in their Y-Chromosome DNA as the root. Because of this,
the M168 Y-Chromosome DNA genetic mutation of the CT haplogroup is thus also sometimes called Eurasian Adam, i.e. it is the
common ancestor of every male living today outside of Africa.
The very ancient African M168 mutation of the Y-DNA Haplogroup CT
went on to further split into three main branches viz: the DE haplogroup, the C haplogroup and the F haplogroup:
DE Haplogroup
i) The Central Asiann D haplogroup has major defining Mutation M174 and the African E haplogroup has major defining Mutations M96, M2, M35, SRY4064, P29, P150, P152, P154, P155, P156, P162).
(N.B. P means Paragroups, which are mutations which define the parent haplogroup, but they do not have any further (known) unique markers.
SRY means location on gene where marker is located.)
As noted earlier on, about 96% of the entire African population today carries the E haplogroup (e.g. sub-haplogroups: E1b1b1, E1b1a, E1b1b2). The D and E haplogroups
are closely related to each other and often called the DE haplogroup. They are both
closely related to each other due to the famous ALU insertion, or YAP insertion or Y Chromosome ALU Polymorphism or just YAP/M1. ALU elements are short
pices of DNA (300 nucleotides in size) that have been inserted in human genome over the past million years. This type of mutation marker is very different
from the other mutation markers which are based on SNPs.
Recall that the very first Y-Chromosome DNA genetic map,
clearly shows the location of the YAP Mutation. It is one of the most unique markers found on the Y-Chromosome, and was
first discovered in 1991 by Professor MF Hammer (University of Arizona). Geneticists have since theorised that the
DE haplogroup evolved first, from the M168 mutation, before then splitting into the separate haplogroups, i.e. D and E haplogroups 70,000 years ago.
Recently in 2012, it was discovered that the YAP insertion and the evidence of previous MtDNA studies indicate an early out of Africa migration to the Indian Andaman and Nicobar Islands,
as well as northeast Indian ethnic groups and this is very significant for understanding the evolutionary history in that region.
C Haplogroup
ii) The C Haplogroup primarily belongs to the Australian Aboriginals (RPS7Y/M130 is the defining mutation), specifically as part of the C4 subclade of the C haplogroup.
F Haplogroup
iii) The very old Central Asiann F haplogroup (major defining Mutation M89) is ancestor to the all remaining other haplogroups and defining mutations found in Asia,
Europe and the Americas (i.e. G, H, I, J, K, L, M, N, O, P, Q, R, S, and T). Lets now turn to the oldest the haplogroup in Asia and Europe.
Oldest Asian and European haplogroups
The M89 mutation of the F haplogroup and the RPS7Y/M130 mutation of the C haplogroup are the two
oldest non-African mutations, (also oldest Asian mutations) dating 60,000 to 50,000 years old.
From the previous Y-DNA phylogenetic tree diagram, we clearly see that the M89 mutation
is the ancestor of all the other Asian haplogroups from G haplogroup to S haplogroup.
The M89 mutation gave rise
to 3 main divisions: M201 mutation (G haplogroup); M69 mutation (H haplogroup) and M9 (K haplogroup).
Every other Asian and European haplogroups from K to T all descended from the M9 (K haplogroup).
Eddy Lzzard Uses His Y-Chromosome DNA To Trace the Journey of Taken by His Ancestors From Africa to Britain 70,000 Years Ago
In March 2013 British comedian Eddy Lzzard submitted his DNA to British geneticist Dr Jim Wilson
for an exciting and informative
2-part BBC produced documentary, Meet The Lzzards. In part 1, Eddy Lzzard used his
mitochondrial DNA to trace the route taken by his mother's ancestors out of Africa 70,000 years ago. In part 2, Eddy Lzzard
used his Y-Chromosome DNA to trace the route the taken by his father's ancestors out of Africa 70,000 years ago.
The simple diagram below illustrates Y-Chromosome DNA epic journey from Africa to England.
Source:
Meet the Lzzards 2-hour (2-part) BBC TV documentary about human evolution.
BBC TV documentary available to view on YouTube.
A (A00) Haplogroup. Africa (Bakola ethnic groups in Cameroon, 190,000 years ago)
F Haplogroup. Middle East (Yemen, Southern Saudi Arabia 60,000 years ago)
H Haplogroup. Middle East (Israel, 50,000 years ago)
R1a Haplogroup. (Eastern and Central Europe, 35,000-20,000 years ago)
I Haplogroup. (More specifically the I2 and I1a sub-haplogroups), Scandinavia, 20,000 years ago,
(start of the Gravettian Culture and distant ancient ancestors of the Vikings)
R1b sub-haplogroup of the R Haplogroup. (Southern France 15,000 years ago)
R1b1 subclade of the R1b Haplogroup. (Northern France, 8,000 years ago)
R1b1 Haplogroup and R1a Haplogroup (ancient Denmark, the Netherlands and Germany). Distant pre-historic ancestors of the people now known as the Anglo-Saxons, Jutes and Angles
3,000 years ago
THEN either of the 3 final migrations to Britain (Before and After the Roman period in Britain)
R1b1b2 Haplogroup (via R1b descendant of the R Haplogroup). Britain, 2000 BC (Celtic migration to Britain from ancient northern France, cousins of the Gauls).
OR
R1a and R1b1 Haplogroup Britain. AD 400s (Anglo-Saxon, Jutes and Angles migration to Britain from Germanic ethnic groups in north western Europe).
OR
I1a (I1) sub-haplogroup of the I Haplogroup Britain. AD 800s (Viking migration to Britain from ancient Denmark and AD 1100s migration of Normans to Britain from France).
What the Diagram Above Means:
When the Celts migrated to Britain circa 2000 BC, they brought along the R1b1b2 sub-haplogroup of the R haplogroup, (R1b1b2 is a R1b descendant).
When the Anglo-Saxons, Jutes and Angles migrated to Britain circa AD 400s, they brought along the R1a sub-haplogroup of the R haplogroup.
When the Vikings migrated to Britain circa AD 800s, they brought along the I1a subclade of the I haplogroup. The Normans originally came from
Scandinavia as Vikings, and when they migrated to Britain circa AD 1100s, they too brought along the I1a (I1) subclade of the I haplogroup.
Most texts such as
Dr Stephen Oppenheimer extra-ordinary book Origins of the British: A Genetic Detective and the enjoyable Blood of the Isles
(published as Saxons, Vikings and Celts: The Genetic Roots of Britain and Ireland in the United States and Canada), all
agree that the majority of British males with English ancestry show three very distinctive three distinctive genealogy ancestries: When a British male with English ancestry submits his Y-Chromosome DNA sample for genealogy tests to trace his ancestors; over 85%
belong to either R1b1b2 (Celtic ancestry); R1a (Anglo-Saxon, Jutes and Angles Ancestry) or I1a / (I1) (Viking and Norman ancestry).
The remaining 15% have an ancestry outside these three groups.
How Long did the above Journey From Africa To Britain Take?
200,000 years ago, anatomically modern man appears in Africa, later migrates to Asia 70,000 years ago,
Europe 45,000 years ago and the Americas 28,000 years ago. Scientists have calculated that
anatomically modern man in Africa only needed to walk 3 miles every 5 years to eventually reach
all parts of the globe (Asia, Europe and the Americas) except Antartica
(which is the only continent in the world with no indigenous population).
2) Y-Chromosome DNA Haplogroups In Turkey and Western Asia
The seven most common haplogroups among others
(present in all four illustrations above) are the F and I (I haplogroup is found mostly Europe, but a small percentages in Turkey and surrounding
areas) and J haplogroup. The J2 subclade of the J haplogroup is found in 90% of the population in Turkey.
(Major Defining Mutations= M89 (oldest non-African mutation and oldest in Asia),
M170, M235, M223, M304, M172, M267).
The J1 subclade of the J haplogroup is the most common the Middle East
such as Saudi Arabia, UAE, Yemen, Iran, Iraq, Syria,
Lebanon, Jordan and Israel. Due to Arab conquest from the 8th century AD, it is also found in North African populations such as Egypt today.
The rest of the common haplogroups found in Western Asia are: the L haplogroup (Major Defining Mutation = M20);
the H haplogroup (Major Defining Mutation= M69); the D haplogroup
(Major Defining Mutation= M174); the N haplogroup (Major Defining Mutation= M231)
and the G haplogroup (Defining Mutation = M201 mutation). All 7 haplogroups representing over
70% of the native population of Turkey and Western Asia (including the Middle East). All the sub-haplogroups and haplogroups mentioned above are
listed in the second detailed Y-Chromosome DNA Phylogenetic Tree diagram shown below.
The J haplogroup is composed of smaller subclades viz: J1, J2 etc. Meanwhile the
L haplogroup appears to have no major subclades.
I haplogroup subclades include: I1, I2 (mostly European haplogroups). Anthropologists associate the I haplogroup
with the arrival of the upper Palaeolithic Gravettian Culture in Europe 30,000 years ago.
N haplogroup is composed of smaller subclades viz: N1a, N1b, N1c.
All the haplogroups and subhaplogroups mentioned above are listed in the second detailed Y-Chromosome DNA Phylogenetic Tree diagram shown below.
3) Y-Chromosome DNA Haplogroups In Europe
(Excluding Turkey). The most Y-Chromosome DNA haplogroup in Europe (present in all four illustrations above)
is the R haplogroup (Major Defining Mutations for the R haplogroup = M343, M173,
M17, M198, M207, P25 and M269 among others),
representing over 75% of the native population of Europe.
Meanwhile the R haplogroup is composed of smaller sub-haplogroups such as: R1b (Western Europe, major defining mutation include: M269, M173, P25, SRY108312,
M343 and P25),
and R1a (Central and Eastern Europe, defining mutation M17). Both are the most common haplogroups in Europe.
Further divisions of R1b sub-haplogroup include: R1b1, R1b1b1 and R1b1b2.
A further R sub-haplogroup known as the
R1b1c is more common outside Europe. The next most common haplogroup in Europe are the
I (the oldest Y-Chromosome DNA Haplogroup in Europe and associated with the Gravettian Culture). Sub-haplogroups
I2 and I1a (defining Mutations: P38 and P30) covers 10% of European population, but is particularly found in larger frequencies
in Scandinavia where it is the majority haplogroup). Furthermore the I2 haplogroup is more common in Greece, Macedonia, Cyprus and several other southeast European nations. The Q and N haplogroups cover 20% of the population,
mostly in Eastern Europe and areas bordering west central Asia such as Eastern Russia.
Other small haplogroups found in Europe include J (less than 3%) and to
some extent E haplogroups (less than 1 %): ExE3b and E3b
(occurs mostly in southern Europe and renamed as E1b1b, it reached Europe via North Africa). The N haplogroup very common in
Finland and Hungary (over 95%). Hungarian and Finnish people and languages are related because the two
share a common origin somewhere east of the Urals. Finnish and Hungarian are members of the
Finno-Ugric branch of the Uralic languages, and thus are not Indo-European languages.
All the sub-haplogroups of the R, I , Q, J, and N haplogroups mentioned above as well as the defining mutations are all
listed in the second detailed Y-Chromosome DNA Phylogenetic Tree diagram shown below.
NEW UPDATED DATA
Although the enjoyable book, The Seven Daughters of Eve shows how the ancestry of 99% of all Europeans can now be traced back to just seven women,
in May 2015, scientists at the University of Leicester in Britain led by Professor Mark Jobling and Dr Chiara Batini have uncovered a more stunning fact:
Most European men descended from just three male ancestors (from the Bronze Age period). Unlike Professor Bryan Sykes who used MtDNA for his discoveries,
the University of Leicester scientists used the other type of marker known as Y-Chromosome DNA.
Recall that the most common Y-Chromosome DNA haplogroup in Europe
is the R haplogroup representing over 75% of the native population of Europe. The R haplogroup itself
is composed of smaller sub-haplogroups
such as: R1b (Western Europe) and R1a (Central and Eastern Europe).
Also recall that next most common haplogroup in Europe are the I haplogroup,
(one of the oldest Y-Chromosome DNA Haplogroups in Europe and associated with the ancient Gravettian Culture).
The sub-haplogroups of the I haplogroup such as I2 and I1 covers 10% of European population,
but is particularly found in larger frequencies in Scandinavia. What the University of Leicester scientists discovered was that,
three distinct mutations occurred in 63% of the 700 male volunteers they tested. The mutations were found in the R1a,
R1b and I1 haplogroups.
Clearly back in the Bronze Age, three ancient men (each one carrying the R1a, R1b and I1 haplogroups)
are the ancestors of over half of European males today.
The above diagram shows the where the majority Y-Chromosome DNA European sub-haplogroups R1a and R1b (R haplogroup) and I1 (I haplogroup) are located. These haplogroups cover just over 75% of
native European population. Making up the other 15% are the I2 subclade (I haplogroup) in south eastern
Europe such as Greece, Macedonia and Albania; N haplogroup in Finland and Hungary and the
J2 subclade (J haplogroup) in Turkey. Outside Europe, you will see the map showing the majority E haplogroup of
North Africa and the J1 subclade of the J haplogroup of south west Asians such as
Saudi Arabia, Iran, Iraq, Syria, Lebanon and Israel. J haplogroup is also found in North Africa (in part due to
arrival of Arabs in the 8th century AD muslim conquest). The above map also shows specific downstream markers or downstream mutations (specific SNPs) e.g.
in the R1a haplogroup, we see downstream markers R1a-Z280, R1a-M458 and R1a-Z284. These specific downstream markers represent further migrations,
For instance for R1a which is more specific to Central and Eastern Europe, the map above shows that a
branch of R1a made its way to Northern Norway and Sweden, i.e. R1a-Z284.
Haplogroup R1b (Y-DNA) from World eBook Library Detailed look at the R1b haplogroup.
You can read more about these mutations and haplogroups in the 2018 book, Tracing Our Genetic Mutations: From Me to You, by Richard Donovan Gover
4) Y-Chromosome DNA Haplogroups In Eastern Asia and Australia
The three most common haplogroups among others
(present in all four illustrations above) are the C haplogroup (Major Defining Mutations= M130,
M216 M8, M210, M105, M131, M217, M93, M347, and M356. M130 also called RPS4Y711); the Q
haplogroup (Major Defining Mutations= M3, and M242) and the O haplogroup
(Major Defining Mutations= M175 and M122), representing over 86% of the native population
of Eastern Asia and Australia. The O haplogroup in particular is very much widespread throughout eastern Asia as
the map below shows as well as Map 3 above. The Australian Aborigines have a very high frequency of the C
haplogroup's M130 / RPSY4Y711 mutation, (i.e. C4 subclade) as the genetic map below shows.
The C haplogroup is composed of smaller sub-haplogroups viz: C1, C2, C3, C4, etc.
Meanwhile the O haplogroup is composed of smaller sub-haplogroups viz: O1, O2, O3 etc.
Q haplogroup has a single Q1 Subclade. The other major haplogroup is the D haplogroup (major defining mutations, M174, IMS-JST021355, PAGES00003).
The above diagram shows the where the majority Y-Chromosome DNA Asian haplogroups and sub-haplogroups are found (O, D, Q, and C). Brief summary: The O haplogroup (shown in blue colour)
in particular is widespread throughout eastern Asia (over 86% of the population). In Siberia and Asian part of Northern Russia,
we find the P and N haplogroups (Ural speakers such as Native Siberians as well as Finland). Haplogroups H and K are found exclusively in India, Pakistan and Sri Lanka.
Haplogroup R which we recall is a big European haplogroup, is also more common in Central Asia, i.e. Kazakhstan, Kyrgyzstan, Uzbekistan, Tajikistan and Turkmenistan. Haplogroups C and M are mostly found in native populations of Australia (Australian Aborigines); Papua New Guinea,
and Melanesian populations found in the Pacific Ocean Islands (e.g. Solomon Islands).
Haplogroup S is found only in Papua New Guinea and some parts of Melanesia and eastern Indonesia (Papua Province or Irian Jaya). Native Japanese people are mostly Haplogroup D and O, but the ancient Ainu of Japan belong to
haplogroup C. Finally haplogroup Q is found in the far east parts of Russia near the Bering Straits (explaining
its presence in Native Americans of the U.S. and Canada).
You can read more about these mutations and haplogroups in the 2018 book, Tracing Our Genetic Mutations: From Me to You, by Richard Donovan Gover
All the major important C, D, Q and O sub-haplogroups and others, as well as the defining mutations, are
listed in the second detailed Y-Chromosome DNA Phylogenetic Tree diagram shown below.
The three African, Asian (incl the Middle East) and European haplogroups maps shown above,
are now summarised in a combined world Y-DNA haplogroup map below:
COMBINED WORLDWIDE GENETIC MAP (Y-CHROMOSOME DNA) OF HUMAN MIGRATIONS.
NEW UPDATED DATA
Finally below is that map of Defining Mutations again, I showed at the start of this segment of section E. See if you can now
understand why the adult male who lived somewhere in Ethiopia and carried the 70,000 year old M168 mutation of the CT haplogroup is called Eurasian Adam
The father of the Eurasian Adam is called Y-Chromosome Adam. He carried the 208,000 year old (142,000 year old) M94
mutation of the A haplogroup. N.B. The M94 mutation is located somewhere in Western Cameroon: look at the map above that says "A00" near a big yellow star.
But some scientists also put the location of M94 mutation in present day Kenya: look on the map below that says "Adam".
What matters here is that the M94 mutation originated in Africa.
The final stages of the early modern human migration out of Africa (as illustrated in the map below) is as follows:
The M168 mutation of the Y-DNA mega haplogroup CT first splits into three main branches viz: the DE haplogroup,
the C haplogroup and the ancient Asian F haplogroup. The C haplogroup splits first
as M130 mutation and migrates all the way to Australia via Southern India coasts, giving rise to the Australian Aboriginals 60,000 years ago.
Next the DE haplogroup splits into the east central Asian D haplogroup M174 mutation (e.g. Tibet, Nepal etc) and the African E haplogroup (discussed in detail already).
The last to evolve from the original CT mega haplogroup is the Middle East F haplogroup with the M89 mutation (it
is thus the ancestor of all the other Asian and European haplogroups from G haplogroup through T haplogroup).
The M89 mutation first gave rise to 5 main divisions G, H, I, J and K haplogroups.
The M201 mutation of the G haplogroup migrated to the Caucasus region etc.
The H haplogroup i.e. M69 mutation migrated to central and southern India.
I haplogroup as M170 mutation stays around the border areas between Asia and Europe, and one branch heads towards northern Europe such as Scandinavia.
J haplogroup as M172 mutation covers much of the Middle East such as Saudia Arabia, Yemen, Lebanon, Syria, Israel and eastern Turkey.
Meanwhile
the M9 (i.e. K haplogroup) crosses central Asia into East Asia and will further split 9 major haplogrops, viz:
L haplogroup as the M20 mutation (e.g Indian sub-continent region),
M haplogroup M106 mutation,
N haplogroup M231 mutation (e.g northern Asia such as Siberia) as well as north eastern Europe such as Hungary and Finland (Europe's non-Indo European languages are spoken in Hungary and Finland).
O haplogroup as the M175 mutation and M122 mutation (e.g. China, Japan, Taiwan, Korea and the rest of East Asia),
P haplogroup as the M45 mutation (e.g Indian sub-continent) and central Asia such as Uzbeskistan,
Q haplogroup (members crossed the Bering Straits between Asia and the Americas i.e. M3 mutation M242 mutation, as the ancestors of North and South America native Americans),
S haplogroup as the M4 mutation and M234 mutation (e.g. Papau New Guinea and many other Melenesian and Micronesian Islands in the Pacific)
and T haplogroup (minority ethnic groups in west and east Asia).
One branch of the K haplogroup M9 mutation moves west towards Europe (45,000 years ago as haplogroup R and via mutations M173, M343 etc).
All these journeys took several hundreds of years and some took
thousands of years. All these haplogroups and defining mutations mentioned above are just the majority ones,
dozens of smaller divisions did occur as well. For instance, we cannot simply refer
refer to the R haplogroup as representing Europe as a whole. Recall that there are parts of Europe that the R haplogroup never reached.
One good example is the N haplogroup which is found in Europe's two
non-Indo-European speaking nations: Hungary and Finland.
Although the very first members of the R haplogroup entered Europe 45,000 years ago, further importnt splits occurred.
Sometime around 30,000 years ago the R haplogroup split into the R1 branch which stayed in Europe and R2 branch which left Europe into the border areas between Europe and Asia.
About 25,000 years ago one branch of R1 known as R1b became the majority branch for Western Europe, while a branch called the R1b became the majority
branch for Eastern Europe. Similar multiple splits also
happened elsewhere, e.g. the E haplogroup of Sub-Saharan Africa, the O haplogroup of Eastern Asia and the J haplogroup of the Middle East. For this reason we often
refer to the haplogroups A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, and R as huge macro haplogroups! The S and T haplogroups did not split into smaller branches.
WORLDWIDE GENETIC MAP (Y-CHROMOSOME DNA) OF HUMAN MIGRATIONS OUT OF AFRICA, 70,000 years ago.
Some Major Defining Mutations
BREAKING NEWS
Mongol Leader Genghis Khan's Y-DNA Lives on in over 16 million Men in Asia Today
In January 2015, scientists from the University of Leicester in Britain announced the result of
a major population genetics project analysing the Y-DNA of over 5,000 Asia men. Two results were amazing:
a) 800 million modern Asian men (84% of Asian male population) are all descended from just 11 men, among them Genghis
Khan who is the ancestor of 16 million Asian men today and a Chinese leader named Giocangga from whom 1.5 million Asia men descend from.
b) These 11 men lived across Asia between 1300 BC and AD 1600, and came mostly from India, China and Mongolia among other places.
The 11 men carried 11 distinct Y-Chromosome DNA Markers (C, F, I, J, L, H, D, N, O, Q, S). These 11 markers are found in 84% of all of Asian men today.
To be brief as possible I have only covered 13 of the 20 major Y-Chromosome DNA haplogroup.
By examining all four diagrams above you can easily work out the remaining 7 haplogroups
and defining mutations, I did not cover in the brief summary. You can also use the second detailed Y-Chromosome DNA Phylogenetic Tree diagram shown below.
A More Detailed Y-Chromosome DNA Phylogenetic Tree
Earlier on I revealed a simplified version of the Y-Chromosome DNA Phylogenetic tree with just over 35
defining mutations. The diagram below shows
a more detailed Y-Chromosome DNA Phylogenetic tree with over 120 defining mutations.
It also shows all most of the sub-haplogroups of the 20 major Y-DNA haplogroups (minus haplogroups S and T).
For instance for the R haplogroup we see the sub-haplogroups: R1, R1a, R1a1, R1a1a, R1a1b, R1a1c, R1b, R1b1, R1b2, R1b1b3(a-g) and
R2.
Although defining mutations have the letter M, if a lineage is not
defined by the presence of a derived marker, then the mutation is given the asterisk, e.g P or asterisk " * "
In Y-Chromosome DNA haplogroups, paragroups are represented by P or an asterisk " * ", placed after the main haplogroup nomenclature.
Paragroups contain the mutations which define the parent haplogroup, but they do not have any further (known) unique markers. Without these unique markers,
they do not form truly independent subclades. The YAP marker or Y Chromosome ALU Polymorphism insertion is clearly shown. Also shown is the unique LLY22
mutation of the N haplogroup discussed earlier on. LLY22 is a good example of paragroups, notice the asterisk " * " after LLY22 in the diagram below.
SRY means location on gene where marker is located.
This detailed Y-Chromosome DNA Phylogenetic tree is a bit old as it actually dates back to 2008,
so it does not include the new A00 haplogroup (still part of the A haplogroup, discussed previously), first given its name in 2013.
Also name changes have occurred since 2009, for instance from 2002 to 2008, we had the African E3b and E3a subclade of the E haplogroup, but from 2009 both are now renamed as E1b1b and E1b1a sub-haplogroups respectively etc.
Both the S and T haplogroups are recent
additions also absent from the diagram below, recall that haplogroups S and T were formerly part of haplogroup K.
International Society of Genetic Genealogy
The most accurate and up to date representation of Y-chromosome DNA haplogroups and
mutations worldwide is maintained by the International Society of Genetic Genealogy, founded in 2005
for the promotion and education of genetic genealogy.
The link of the Y-DNA Haplogroup Tree 2018 of the ISOGG is given below:
International Society of Genetic Genealogy Y-DNA Haplogroup Tree 2018
This database covers all 20 major Y-Chromosome DNA haplogroups,
A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S and T as well as the 36 major MtDNA haplogroups,
discussed earlier on in this ebook: A; B; C; CZ; D; E; F; G; H; HV; I; J; Pre JT; JT; K; L0; L1; L2; L3; L4; L5; L6; M; N; P; Q; R; R0; S; T; U; V; W; X; Y; and Z.
Each year research institutes around the world analyse different Y-Chromosome
DNA samples from volunteers and send the results to the ISOGG. The various data come from global network of research centres in:
Algeria, Australia, Bahamas, Barbados, Belgium, Bermuda, Bosnia & Herzegovina, Brazil, Bulgaria, Canada, Czech Republic, Colombia, Costa Rica, Croatia, Curaçao, Cyprus, Denmark, Ecuador, Egypt, England, Ethiopia, Finland, France, Germany, Ghana, Greece, Hungary, India, Indonesia, Ireland, Isle of Man, Israel, Italy, Japan, Jordan, Kuwait, Libya, Luxembourg, Malaysia, Mariana Islands, Mauritius, Mexico, Mongolia, Namibia, Netherlands, New Zealand, Nigeria, Northern Ireland, Norway, Pakistan, Philippines, Portugal, Puerto Rico, Qatar, Romania, Russia, Scotland, South Africa, Spain, Saint Vincent and The Grenadines, Saudi Arabia, Seychelles, Sweden, Switzerland, Taiwan, Thailand, The Congo, Trinidad & Tobago, Tunisia, Turkey, Wales, United Arab Emirates, United States, Venezuela and the U.S. Virgin Islands.
International Society of Genetic Genealogy homepage
An interesting link at the ISOGG homepage is a link called "Famous DNA"
It contains 6 sections titled: Famous DNA, Famous Haplogroups, Founding Father DNA, Ancient DNA, Neanderthal DNA and Presidential DNA. Basically it examines
the amazing analysis of the DNA of famous and ancient people. For instance in the section called "Famous DNA" we learn that the DNA of the chance discovery of the remains of the Romanovs ( Russia's last royal family) was positively identified some 90 years later after they were assassinated by the communists. In the section called "Ancient DNA we lean about the mysterious Beothuks, an extinct Native American indigenous tribe no one knew about. Analysing the DNA of past famous and ancient people is an exciting and educative affair.
N.B. Remember it is actually genes in the cell's nucleus DNA that determine ethnic group, and not the genes in the Y-Chromosome DNA.
While Y-Chromosome DNA mutations tell us when and where exactly different ethnic groups emerged around the world at different points in time via migration out of Africa,
for each point where a different Y-Chromosome DNA marker arose (due to mutation in Y-Chromosome DNA), we can say with certainty that a corresponding mutation in nuclear DNA
had occurred just before or after the mutation in MtDNA,
leading to a specific genetic trait.
For instance the genes that control skin colour, via regulating the production of melanin, are only found in the nucleus DNA.
Y-Chromosome DNA tells us that about 70,000 years ago once ancient humans left Africa carrying the M168 Y-Chromosome DNA mutation and entered Yemen, a mutation
occurred leading to a different Y-Chromosome DNA marker: the M89 Y-Chromosome DNA mutation.
Thus likewise 70,000 years ago a mutation occurred in the nuclear DNA (at chromosomes 15, 16 and 19) that led to a specific genetic trait:
different skin colour pigmentation. In all human cells, chromosome 15, 16 and 19 in the nucleus determines skin, hair and eye colour of an individual.
With this in mind, you may wonder: Did some sort of commuication occur between Y-Chromosome DNA and nuclear DNA? Which mutation was triggered first, Y-Chromosome DNA
or Nuclear DNA?
Scientists do note that although the genes in Y-Chromosome DNA and nuclear DNA are different in function Y-Chromosome DNA DOES exchange signals with nuclear DNA.
How and why these exchange of signals occur is
beyond the scope of this eBook.
From all the genetic maps above, we see that there are 36 major Mitochondrial DNA or MtDNA markers
and about
20 major Y-Chromosome DNA or Y-DNA markers.
DNA Testing Today
NEW UPDATED DATA
Lets now look at the analysis of Y-Chromosome DNA and Mitochondrial DNA, as well as Autosomal DNA, for genealogical purposes.
a)
When a person (male or female) submits their MtDNA for DNA ancestry testing, the DNA tests can either use the whole MtDNA or just the MtDNA D-Loop to
locate SNPs.
For instance the test known as mtFullSequence (FMS) is a complete MtDNA test, providing detailed information on
haplogroups. Meanwhile the test known as mtDNAPlus
only uses the MtDNA HVR1 and HVR2 hypervariable regions of the D-Loop and only gives basic haplogroup information. We discussed MtDNA D-Loop and SNPs earlier on.
b)
When a person (male) submits their Y-DNA for DNA ancestry testing, the DNA tests can use the MSY regions to locate STRs and/or SNPs. STR means
Short Tandem Repeats.
We thus have two choices: Y-STR DNA Tests or Y-SNP DNA Tests. SNP testing is very specific and required to confirm which Y-DNA haplogroups and subclade you belong to,
thus enabling the tests to learn more about your deep ancestry, since Y-SNP tests can
reach much further back in time, say last 10,000 years. Y-STRs are useful genealogically (predicting haplogroup), to determine to whom you match within a recent timeframe, of say, the past 500 years or so. Therefore if you want to trace ancestors going back at least 5,000 years you need to do a
Y-SNP DNA Test, this is because in SNPs there is one change every 2,000-5,000 years (i.e mutation rate of Y-DNA SNPs is every 2,000-5,000 years), but in STR there is one change every 80 years. If you are an American, Brazilian, or Canadian etc and want to trace ancestors going back to say 1492
you need to do a
Y-STR Test DNA.
In 2013, new type of Y-DNA test called The Big Y was announced by the DNA testing firm, Family Tree DNA. The Big Y test sequences at a larger part of the Y chromosome than
done previously.
Y-STRs are
usually designated by DYS numbers (the scientific name for STRs
found on the Y-Chromosome DNA). Remember STR is a different kind of a mutation than a SNP.
We discussed MSY region earlier on. For detailed information on STRs, as well as a good diagram showing Y-STR DNA tests in action, see the sub-heading "Using Nuclear DNA (or Autosomal DNA) for Human
Ancestry research and Population genetics Projects"
N.B. It must be emphasised at this point that Y-Chromosome DNA and Mitochondrial DNA tests alone
CANNOT give an overall complete picture of one's ancestry. There is also a need to do tests to determine
what is commonly known as Ancestral Information Markers or AIM. These markers are sets of
SNPs for a location on a chromosome (i.e. locus) and are normally in different frequencies in different populations in different geographic regions. The need to perform tests to
locate Ancestral Information Markers becomes aparent in the Americas such as in the U.S., Dominican Republic and Brazil. Here we see a very high degree of
admixture, with the extensive mixing of African, European and Native American
gene pools, due to
history and emigration in the Americas. Thus Ancestral Information Markers can compliment to a great deal Y-Chromosome DNA and Mitochondrial DNA tests and produce
highly accurate ancestry information approaching 100% accuracy!!
c)
When a person (male or female) submits their Nuclear DNA or atDNA, for Autosomal DNA ancestry testing, the DNA tests
looks at around 500 to 5000 SNPs across the 22 autosomal chromosomes or looks for specific groups of STRs across the 22 autosomal chromosomes. This type of
testing is more commonly done for paternity or maternity tests or for forensic science identification i.e genetic fingerprinting.
For detailed information on Nuclear DNA for ancestry testing, see the sub-heading "Using Nuclear DNA (or Autosomal DNA) for Human Ancestry research and Population genetics Projects" By 2014, scientists estimated that modern humans today have just over 10 millions SNPs (i.e. mutation markers),
across the total population of humans; no single human has all the SNPs.
Geneticits have long discovered that SNPs occur normally throughout a person’s DNA. They occur in humans once in every 300 nucleotides on average,
which means there are roughly 10 million SNPs in the human genome.
There are over a dozen major companies doing DNA tests (Y-Chromosome DNA and/or Mitochondrial DNA, and/or Autosomal DNA) for genealogical purposes. Its always exciting to
discover where your great-great-great-great grand dad or mum came from originally. Among the most prominent are:
a) Family Tree DNA (Gene by Gene);
b) 23andMe;
c) Genetrack, U.K.;
d) Genographic Project (Geno 2.0);
e) DNA Worldwide, U.K.;
f) AncestryDNA, U.K.;
g) Genebase Systems;
h) Oxford Ancestors;
i) YSEQ;
j) Ancestry.com;
k) Chromo2;
l) Full Genomes Corporation;
A good list of DNA testing companies
You can read more about DNA testing in Matthew Helm's book Genealogy Online For Dummies, or
Who Do You Think You Are? Encyclopedia of Genealogy: The Definitive Reference Guide to Tracing your Family History
by Nick Barratt.
MY OWN DNA TESTS RESULTS
I was amazed to be told my DNA tests results back in 2013 show
that although I was born in London, U.K. I have Scottish, Tuareg, and West African DNA!
My haplogroups are: E1b1a8a, L3e2a1b1 (West African DNA, 90%); and traces of H1v1b (North African Tuareg DNA, 6%) and R1a1a/M17 (Scottish DNA, 4%).
After much research I have concluded that the Tuaregs (originally from North Africa) and who are versatile nomads,
were very common in parts West Africa from the 1500s, and most probably a group of them had a chance sexual encounter with
one of my distant ancestors somewhere in West Africa circa late 1600s. My trace Scottish DNA comes from Scottish
missionaries who came into contact with my father's maternal ancestors in the early 1800s.
NEW UPDATED DATA
In 2013, African-American molecular biologist, Dr Rick Kittles submitted his DNA to 23andMe for an Autosomal DNA (atDNA) ancestry test.
Days later the DNA test revealed the results of Autosomal DNA on his 22
autosomal chromosomes (i.e chromosome pairs 1 to 22). It showed that apart from his 80% African ancestry,
Dr Rick Kittles also had 12% European ancestry and 8% Native Indian ancestry in his genome.
Had his DNA test also included MtDNA and/or Y-DNA tests, it would have indicated which European and African
nations contributed to his African and European ancestries.
Chromosomes 15, 16 and 19 and Skin, Hair and Eye Colour
You will notice in the above diagram, that chromosome 15 in Dr Rick Kittles autosomal DNA is 99% African. A geneticist who did not know who Dr Rick Kittles was,
could by looking at
genes on chromosome 15, estimate his ancestry: Chromosomes 15, 16 and 19 are the location of important genes that determine eye and skin pigmentation, such as the
OCA2 gene AND the HERC2 gene, on chromosome 15, which both determine eye colour and the SLC24A5 gene responsible for light skin colour (all three are on chromosome 15). Meanwhile
another major gene is the MC1R gene or (the melanocortin 1 receptor gene) that produces brown to dark skin colour
or high levels of Melanin. The MC1R gene is located chromosome 16. The HCL gene (responsible for hair colour) is located on chromosome 19.
BREAKING NEWS:
In February 2018, British scientists at University College London and the Natural History Museum London were able to analyse
the genome (for genetic markers like SNPs, discussed in Section E) of the famous 10,000 year old Ceddar Man fossils discovered
at Gough's Cave in
Somerset (discussed in detail in Section I) and made an important discovery: SNPs for the genes that give dark skin colour in
modern humans i.e. the MC1R gene, were found in Cheddar Man's genome. Instead of finding only SNPs for SLC24A5 genes on chromosome 15 and no SNPs for MC1R genes on chromosome
16 on Cheddar Man's decoded genome, they found SNPs for MC1R genes instead on chromosome 16 and no SNPs for SLC24A5 genes on chromosome 15. This suggests the SLC24A5 gene that
gives light skin colour in modern humans may have only appeared in some migrants to Europe
after at least 10,000 years ago, and not before 10,000 years ago in migrants into Europe. Recall that modern humans arrived Europe roughly 45,000 years ago. This also means that
while evolution got to work enabling lighter skin colour to be manifested in modern humans migrating from Africa to Europe, not all the migrants had
lighter skin colour changes to
enable the skin absorb more sunlight to make vitamin D in cold climates. Some early modern humans arrived modern Europe with darker skins colours
(as supported by the Cheddar Man discoveries in February 2018).
But Natural Selection was the reason why all the remaining darker skin ancient human migrants in Europe had lighter skin colour eventually.
Today the MC1R gene remains inactive in modern day Europeans (i.e. European ancestry) on chromosome 16 due to a permanent mutation, meanwhile
active variants of the SLC24A5 genes are found on chromosome 15 in modern day Europeans (i.e. European ancestry). But an analogy of the MC1R gene presents itself when modern Europeans
visit hot tropical climates for holidays such as Brazil or North Africa and get a temporary skin tan. The skin tan is not due to the inactive MC1R gene being reactivated but simply the exposure to longer periods
of the sun in hotter tropical climates directly causing melanin genes in skin cells to produce large amounts of melanin.
Take for instance the
human gene known as OCA2, which controls the colour of the eyes (blue, brown, hazel, green etc), in general, brown is the most
common eye colour, followed by blue, grey and then green). Human eyes are fascinating - just take a look at the many different shades of eye colour and the intricate, unique iris patterns from all over the world. What we call eye colour is actually the colour of the part of the eye known as the iris.
But the expression of OCA2 gene largely depends on the levels of melanin in the eyes (produced by the other genes mentioned before above), very little melanin in skin cells then
blue eyes normally results (the reason why blondes are mostly blue-eyed). More than average Melanin, then brown or dark brown eyes results,
depending on Melanin content, in other words: eye colour is tied to hair and skin colours. The OCA2 gene has a well known location on the chromosome 15 in
all humans: The OCA2 gene is located on the long (q) arm of chromosome 15 between positions 11.2 and 12.
More precisely, the OCA2 gene is located from base pair 25,673,627 to base pair 26,018,060 on chromosome 15. It is easy to find and study by geneticists. Originally humans around the world, all had only brown eyes, but a genetic mutation affecting the OCA2 gene resulted in the creation of a "switch," which literally "turned off" the ability to produce brown eyes. The OCA2 gene codes for the so-called P protein, which is involved in the production of melanin. The "switch," which is located in the gene adjacent to OCA2 does not, however, turn off the gene entirely, but rather limits its action to reducing the production of melanin in the iris -- effectively "diluting" brown eyes to blue. The switch's effect on OCA2 is very specific therefore, if the OCA2 gene had been completely destroyed or turned off, all human beings would be without melanin in their hair, eyes or skin colour, a condition known as albinism.
Scientists have identified three different changes in the OCA2 gene that also contributed to blue eyes. The HERC2 gene regulates the OCA2 gene expression. In places like Scandinavia, a common polymorphism in HERC2 gene (the SNP loci rs1129038 and rs12913832 in the HERC2 gene) is responsible for the blue eye phenotype. A person who has two copies of C allele at HERC2 rs1293832 will likely have blue eyes while homozygous TT predicts likely brown eyes. New research shows that all people with blue eyes today, have a single, common ancestor. Scientists have tracked down a genetic mutation which took place 6,000-10,000 years ago and is the cause of the eye color of all blue-eyed humans today.
Meanwhile Sue Griffith, a European-American living in southern California, did 4 different DNA tests using
mitochondrial DNA (MtDNA) AND autosomal DNA (atDNA), to prove her European ancestry and her UK ancestry (the source of her European ancestry).
In the link below, she shares the results of the 4 DNA tests.
Results of the 4 DNA tests for an American
The Origin of Ethnic Groups Seen Today In this section, I discuss in great detail how the
different ethnic groups emerged, after modern humans left Africa, 70,000 years ago.
SNP Ancestry Databases
The SNPedia and Promethease Databases and DNA Ancestry Testing.
Access to SNPedia
SNPedia is a wiki-based bioinformatics web site that serves as a database of single nucleotide polymorphisms or SNPs. Each article on a SNP provides a short description, links to scientific articles and personal genomics web sites, as well as microarray information about that SNP. Thus SNPedia may support the interpretation of results of personal genotyping from, e.g., 23andMe, Navigenics, deCODEme, or Knome. SNPedia is a semantic wiki, powered by MediaWiki and the Semantic MediaWiki extension. SNPedia was created, and is run by, geneticist Greg Lennon[2] and programmer Mike Cariaso, who at the time of the site's founding were both located in Bethesda, Maryland. As of 29 July 2015, the website has 73,310 SNPs in its database. The number of SNPs in SNPedia has doubled roughly once every 14 months.
Access to Promethease
An associated freeware computer program called Promethease, also developed by the SNPedia team, allows users to compare personal genetics results against the SNPedia database, generating a report with information about a person's attributes, such as propensity to diseases, based on the presence of specific SNPs within their genome. Promethease is thus literature retrieval system that builds a personal DNA report based on connecting a file of DNA genotypes to the scientific findings cited in SNPedia. Biomedical researchers, healthcare practitioners and customers of DNA testing services (such as 23andMe, Ancestry.com, FamilyTreeDNA, etc.) use Promethease to retrieve information published about their DNA variations. Most reports cost $5 and are produced in under 10 minutes. Much larger data files (such as imputed full genomes from dna.land) cost $10 and have increased runtime.
RECAP SO FAR
Updates on the Y-Chromosome DNA genetic maps
N.B. Y-Chromosome DNA genetic marker maps are constantly being updated in genetics research labs worldwide, hence the Y-Chromosome DNA genetic map shown above
will change with more major markers (major haplogroups) added from time to time. Dr Cruciani and his colleagues at the University of Rome, in Italy, provided
one of the most recent major update in 2011. Source: Cruciani, Fulvio; Trombetta, Beniamino; Massaia, Andrea;
Destro-Bisol, Giovanni; Sellitto, Daniele; Scozzari, Rosaria (2011).
A Revised Root for the Human Y Chromosomal Phylogenetic Tree: The Origin of Patrilineal Diversity in Africa,
American Journal of Human Genetics 88 (6): 814–8.
In 2014 the consensus among geneticists worldwide is that
there are however 21 major Y-Chromosome DNA haplogroups, not 20 major Y-Chromosome DNA haplogroup as noted throughout this ebook.
The complete list of the 20 major Y-Chromosome DNA haplogroups remains:
A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S and T.
Updates on the MtDNA genetic maps
The latest 2013 genetic research labs show there are 36 major MtDNA Haplogroups or 36 Macro haplogroups or 36 Clades
MtDNA genetic marker maps are constantly being updated in genetics research labs worldwide,
hence the MtDNA genetic map
shown above
will change with more major markers (major haplogroups) added from time to time.
In 2014 the consensus among geneticists worldwide is that
there are indeed 36 major MtDNA haplogroups.
The complete list of the 36 major MtDNA haplogroups are: A; B; C; CZ; D; E; F; G; H; HV; I; J; Pre JT; JT; K; L0; L1; L2; L3; L4; L5; L6; M; N; P; Q; R; R0; S; T; U; V; W; X; Y; and Z.
Sometimes there is a union of two haplogroups such as H and V, this is indicated by juxtaposed letters HV.
Using Nuclear DNA (or Autosomal DNA) for Human Ancestry Research and Population Genetics Projects
With both MtDNA and Y-Chromosome DNA (chromosome number 23), the two favourite
sources for human ancestry and population genetics research, what about the nuclear DNA found in the nucleus (chromosome numbers 1 to 22) ? The good news is that while
nuclear DNA is far more complex and bigger (3 billion nucleotides in length) than either MtDNA and Y-Chromosome DNA,
subsequent, more sophisticated analyses using DNA from the nucleus of cells (or Autosomal DNA) to some extent
HAVE confirmed the results from MtDNA and Y-Chromosome DNA. Yes we can also use nuclear DNA
to explain human migration out of Africa.
A very big population genetics study in January 2008 compared nuclear DNA
(by examining about 500 Single Nucleotide Polymorphisms or SNPs) from 938 people from 51 parts of the world.
The nuclear DNA used for the research project was obtained from the Paris-based Centre for the Study of
Human Polymorphisms. This research, the most comprehensive and largest survey of human diversity
before 2008, traced our common ancestor to Africa and clarified the ancestries of several populations
in Europe, Middle East and Asia, discovered previously with MtDNA and Y-Chromosome DNA.
Microsatellites
The 2008 research project also used another different clever method, not based on SNPs, but based on specific
repetitions of DNA nucleotide segments (groups of up to 10 DNA base-pairs that are repeated in short sequences)
in specific parts of nuclear DNA. Short repetitive nucleotide segments in
nuclear DNA (known as Microsatellites or Short Tandem Repeats)
serve as very good genetic markers, the same way SNPs in MtDNA and Y-Chromosome DNA serve as
genetic markers discussed earlier on in this ebook.
By the way Microsatellites (i.e. Short Tandem Repeats or STR) can also
be used as genetic markers on the Y-Chromosome DNA alongside SNPs!
Therefore, when a person (male or female) submits their Nuclear DNA for DNA ancestry testing, the DNA tests
looks at around 500,000 SNPs across the 22 autosomal chromosomes or looks for STRs across the 22 autosomal chromosomes.
How Short Tandem Repeats or STR Changed Forensic Science Forever
One really fascinating thing about Short Tandem Repeats is that they are very very accurate in forensic science
for identification purposes.
The development of STR for nuclear DNA identification or Genetic Fingerprinting
first began in 1994 when
British molecular geneticist
Dr Alec Jeffreys showed it was possible to use nuclear DNA profiles in solving crimes,
the same way fingerprints are used. Soon scientists narrowed down using just STRs in nuclear DNA.
Today the analysis of Short Tandem Repeats on autosomal, X and Y chromosomes
(which is the very basis for Genetic Fingerprinting worldwide)
can reveal if a person's DNA (from blood, saliva, sweat, semen samples etc) comes from a man or woman OR if the DNA comes from
a person with Africa, Asia or European ancestry. Deep further analysis of Short Tandem Repeats can
create very specific DNA Profiles for one person out of 6.7 billion people in the world. One very specific genetic fingerprint no one else has!!
So if a suspect is DNA tested for Short Tandem Repeats,
this profile can either be matched if it is already on a DNA database (a database of DNA profiles from millions of people, built up over time such as the American National DNA Index System or NDIS).
Or the DNA profile is stored on a DNA database for the first time for future use for future reference. So accurate is Short Tandem Repeats DNA profiling,
that it has solved so many crime cases worldwide in courts of law, where other evidence
was short-coming or circumstantial.
As I previously explained earlier on in this ebook in Section E under the heading "
Mitochondrial DNA: Extraction, Isolation and Sequencing" normally takes from a couple of hours up to 2 or more days for standard
DNA profiles to be made in a police labs, research labs etc.
The American company IntegenX changed all that with the
introduction of the world's first portable DNA profiling machine, named the RapidHIT 200.
This machine the size and weight of a medium sized home printer, which
can be operated by non-scientists, is given DNA samples put in a
special rectangular plastic cartridges, and in under
2 hours it can analyse the DNA for SNPs and STRs (Short Tandem Repeats) via automated DNA extraction, PCR and other molecular genetics technologies such as Promega's PowerPlex® 16 SystemHS. Incidentally
Promega is one of two main suppliers of systems for genetic identification based on
DNA analysis of short tandem repeats. Promega was the first company to provide specific enzyme kits
that make STR and SNP analysis of single loci possible, for machines like RapidHIT 200 to use for the DNA analysis part . The other main supplier of enzyme kits is Applied Biosystems. Once RapidHIT 200 has
finished the DNA analysis for STRs and SNPs
it instantly builds up an accurate DNA profile based on the SNPs and STRs it finds! That's not all, it can print out the DNA profile on a photographic glossy paper or use
specialised software built into the RapidHIT 200 to digitally connect to a host of
DNA database servers via the Internet or local network (intranet) and look for a match!! All this in under 2 hours.
the RapidHIT 200 machine
How Short is Short?
Segments of tandemly repeated DNA (on Nuclear DNA) with a short repeat length, are usually
2-5 nucleotide base-pairs (up to 10 base-pairs). These short sequences of nucleotides
are repeated over and over again a variable number of times in tandem.
This is sufficient for human ancestry and population genetics research.
Compare this with just one SNP (i.e one nucleotide base-pair swap) used on Mitochondrial DNA and
Y-Chromosome DNA, which by itself is also a very good genetic marker. When the segments of tandemly repeated DNA are 10 to 60 nucleotide base-pairs,
they are called Minisatellites.
This is what STRs looks like on nuclear chromosome DNA.
Copyright © Steve Jurvetson·
When a person (male) submits their Y-DNA for DNA ancestry testing, the DNA tests can use the MSY regions to locate STRs and/or SNPs.
We thus have two choices: Y-STR DNA Tests or Y-SNP DNA Tests. Y-STRs are usually designated by DYS numbers (the scientific name for STRs
found on the Y-Chromosome DNA). STR tests can be for 37, 67 or 111 markers. When we test for STR markers we are looking for short repeats of DNA that are repeated over and over and those number of repeats are called allele values. Some STR markers contain a wide range of repeats, like Y-STR marker DYS385a/b which has a repeat range of 6 to 28. On the other hand, some STR markers like DYS 426 contain a narrow range of repeats, spanning from 10 to 13.
As a general rule of thumb if you share the same number of repeats with another person across a wide range of
STR markers then you are related to them and the more you share the more recent your most common ancestor is likely to have been.
In the diagram above a male volunteer from Estonia,
submitted his Y-DNA for Y-STR DNA Test, which showed that he has the L22Y mutation, derived from the M9 mutation (south west Asia such as Iran), derived from the M89 Mutation (the Middle East)
which derived from the M168 mutation (Africa). It places the Estonian donor in Haplogroup N.
Since this HTML ebook is a popular science text, I will not go into complex
details of how the exact
Y-DNA analysis was undertaken. More experienced readers are referred to use advanced academic texts such as
Human Evolutionary Genetics by Mark Jobling, Edward Hollox et al. ISBN-13: 978-0815341482. You can also do a Google search with the words: DYS, Y-DNA STR test, haplogroup, etc.
Why are Microsatellites preferred to SNP in Nuclear DNA tests?
Nuclear DNA is far more complex and very much bigger in size (remember 3 billion nucleotides in length)
than either MtDNA and Y-Chromosome DNA. It would be impractical to use SNPs as markers the same way
they are used in Mitochondrial DNA and Y-Chromosome DNA. Remember
that humans have about 10 millions SNPs across the total population of humans,
although no single human has all the SNPs. Hence instead of using substitutions we use repeats.
Recall earlier on in this ebook I asked: How is a mutation in MtDNA spotted? and explained
that Mutations in MtDNA are easily located by looking for what geneticists term substitutions. I also explained that Mutations in Nuclear DNA are easily located by looking for what geneticists term Repeats AND Deletions. Looking for mutations via substitutions means looking for SNPs. Because Nuclear DNA mutations can involve Repeats AND Deletions of nucleotides, scientists can use these types of mutations to study ancient human migrations patterns out of Africa.
Geneticists call insertions into or deletions of DNA INDELS. There are just over 26,000 indels in the human genome!
(i.e. the 3 billion nucleotide base pairs in nuclear DNA have over 26,000 indels).
Good News About SNPs and DNA Testing
Although Microsatellites or STRs are preferred to SNP in Nuclear DNA tests, that is not to say the 10 million SNPs in humans is ignored. Scientist have located about 5000 SNPs that can be used for identification purposes. Thus when
a person (male or female) submits their Nuclear DNA or atDNA, for
Autosomal DNA ancestry testing, the DNA tests looks at around 500 to 5000 SNPs across the 22
autosomal chromosomes OR looks for specific groups of STRs across the 22 autosomal chromosomes.
Today REPEATS of nucleotides (microsatellites or Short Tandem Repeats) alongside substitutions of nucleotides (SNPs) are both very strong tools for studying human evolution via studying genetic markers as well as population genetics. The good news is that Nuclear DNA, alongside MtDNA and Y-Chromosome DNA all finally
confirm that the first anatomically humans date back just over 200,000 years ago
to someone called Mitochondrial Eve and Y-Chromosome Adam, in Africa.
Sources for the extensive 2008 research project using Nuclear DNA microsatellites
:
a) Smithsonian Institution magazine, May 2008. The Great Human Migration:
Why humans left their African homeland 80,000 years ago to colonise the world
Smithsonian Institution magazine, May 2008
b) Scientific American, July 2008 issue: Traces of a Distant Past by Gary Stix,
and
c)
Mapping Human History: Discovering Our Past Through Our Genes by Steve Olson, 2001. (N.B.
It was published before the 2008 project, but it does describe in detail how nuclear DNA can be used in population genetics and human ancestry research.)
Copyright © James Shreeve, Biological Anthropology: The Greatest Journey, 2006. National Geographic Learning Reader.
The above diagram simplifies how the two widely used genetic markers (MtDNA and Y-Chromosome DNA) tell us about our ancestry.
It confirms that the oldest Y-Chromosome DNA marker found outside Africa is the M168 marker, which descended from the African M94 marker.
The above diagram is a good example of DNA profiling showing ancient migrations routes of humanity.
For example the diagram above for example, we see that the order in which the markers appear also
show us the exact route taken by the ancestors of Native Americans from Africa to the Americas.
M91 of specific haplogroup BT in Africa (90,000 years ago) M168 East Africa (70,000 years ago)
M89 Middle East (50,000 years ago) M9 Central Asia (40,000 years ago) M45 Central Asia (30,000 years ago)
M242 East Asia (28,000 years ago) M3 the Bering Straits en-route to North America, the final destination (10,000 to 20,000 years ago).
Example of What The Two Different Types of Genetic Markers Tell Us
Using continental Europe as an example, from all the detailed MtDNA and Y-Chromosome DNA genetic maps and diagrams given above
we have following example of what these two types of genetic markers tell us: The most common MtDNA genetic lineage found in Europe is the H MtDNA genetic marker
(found exclusively in 49% of all European population today).
Likewise the most common Y-Chromosome DNA genetic lineage found in Europe is the R Y-Chromosome DNA
genetic marker (mainly R1b and R1a sub-haplogroups
with the defining mutations M269, M173, P25 and M343)
found exclusively in 75% of all European population today.
The most common subclades of R1b sub-haplogroup include: R1b1, R1b1b1 and R1b1b2.
NEW UPDATED DATA
Although the enjoyable book, The Seven Daughters of Eve shows how the ancestry of 99% of all Europeans can now be traced back to just seven women,
in May 2015, scientists at the University of Leicester in Britain led by Professor Mark Jobling and Dr Chiara Batini have uncovered a more stunning fact:
Most European men descended from just three male ancestors (from the Bronze Age period). Unlike Professor Bryan Sykes who used MtDNA for his discoveries,
the University of Leicester scientists used the other type of marker known as Y-Chromosome DNA.
Recall that the most common Y-Chromosome DNA haplogroup in Europe
is the R haplogroup representing over 75% of the native population of Europe. The R haplogroup itself
is composed of smaller sub-haplogroups
such as: R1b (Western Europe) and R1a (Central and Eastern Europe).
Also recall that next most common haplogroup in Europe is the I haplogroup.
(one of the oldest Y-Chromosome DNA Haplogroups in Europe and associated with the ancient European Gravettian Culture).
The I haplogroup sub=haplogroups such as I2 and I1 covers 10% of European population,
but is particularly found in larger frequencies in Scandinavia. What the University of Leicester scientists discovered was that,
three distinct mutations occurred in 63% of the 700 male volunteers they tested. The mutations were found in the R1a, R1b and I1 haplogroups.
Clearly back in the Bronze Age, three ancient men (each one carrying the R1a, R1b and I1 markers)
are the ancestors of over half of European males today.
Another Easy to understand scientific paper on the
Y-Chromosome DNA genetic markers and MtDNA genetic markers for dummies
Wikipedia has provided an interesting study of which reveals a list of the haplogroups of notable people from the famous 8000 year old Italian mummy ice called Otezi, to famous and infamous people.
See:
List of haplogroups of notable people
THE FINAL ANALYSIS
Since the famous 1987 MtDNA study, in the ensuing years, massive amounts of genetic research worldwide has laid
to rest any doubt about our African origin. While all non-African females
are descendants of L3 line from Africa, our earliest common father was one with a
Y chromosome marker, M168.
We are all Africans in origin 200,000 years ago. Today we share a common genetic ancestry
that far outweighs physical or cultural differences – we may be of different colours, shapes or
cultures or customs, or speak thousands of languages, but all human DNA
is 99.9 percent identical.
-------------------------------------------------------------------------------------------------------
End of the genetics tutorial on human ancestry and now let the story continue...
42,000 BC (45,000 years ago), a group archaic Homo sapiens living in
the Middle East (who descended from Mitochondrial Eve) moved west via
Cro-Magnons are the earliest known form of anatomically modern humans found in Europe, dating from about 35,000 to 45,000 years ago.
The first Cro-Magnon thus arrived 45,000 years ago.
Another second migration of Homo sapiens into Europe, took place circa
35,000 to 10,000 years ago and replaced most earlier Cro-Magnon populations.
It is difficult to determine how long the Cro-Magnons in Europe, lasted and what happened to them.
Presumably they were gradually absorbed into the European populations that came later on .
Individuals with some Cro-Magnon characteristics, commonly called Cro-Magnoids,
have been found in the Mesolithic European Period (8000 to 5000 BC) and the Neolithic European
Period (5000 to 2000 BC). Due to the last Ice Age, modern humans arrived Asia and Australia before Europe.
Most paleoanthropology books define the Cro-Magnons as follows:
The Cro-Magnons were early modern humans (Homo sapiens)
who occupied Europe during the last periods of the Neanderthals from about 45,000 years ago to 10,000 years ago.
Cro-Magnons lived side by side with the Neanderthals for at least 5,000 years
before the Neanderthals went extinct circa 39,000 years ago.
What Happened When the Cro-Magnons Encountered the Neanderthals About 43,000 years ago
In 2014 Professor Thomas Higham (Oxford University) performed the
most comprehensive dating of Neanderthal bones and tools ever carried out,
which confirmed that Neanderthals died out in Europe (Southern Spain and Gibraltar) 39,000 years ago.
BREAKING NEWS
In 2014, new samples of Cro-Magnon fossils found in Pestera cu Oase in Romania
indicated that Neanderthal genes were present in the fossils in much higher proportions than previously thought.
Between 11% and 48% of the genes in these newly discovered
Cro-Magnon had Neanderthal genes, indicating that lots of sexual encounters took place between the
Cro-Magnons and Neanderthals in Pestera cu Oase from 45,000 years ago.
2014 science journal, reports that more than 2% of Eurasia populations today have Neanderthal DNA.
A lot more sexual encounters between Neanderthals and ancient modern humans took place
Origin of Skin Colour: The Origin of Human Ethnic Groups
The final glaciations of the last Ice Age lasted from 750,000 years ago to 12,000 years ago in Eurasia and the Americas and to adapt to extreme
low temperatures and subsequent cold environment, the arriving modern humans (i.e. Homo sapiens sapiens)
that left Africa 70,000 to 51,000 years ago
further evolved to acclimatise to the new cold environments and periodic climate
change leading to the different ethnic groups seen in Asia and
On a world map, most people living 100 miles above, below or near the equator, generally speaking are
exposed to the most sunlight per day, so their early ancestors developed more pigmentation.
This is the reason why Dravidian southern Indians
have more pigmentation that northern Indians, because the south of India is closer to the equator. The diagram below also shows that the further north from the equator one goes the lesser the skin pigmentation, as in ancient times our ancestors were exposed to less sunlight the further north from the equator and the Tropic Of Cancer.
The above map is based on Von Luschan's chromatic scale.
Named after its inventor, Felix von Luschan (an Austrian doctor and anthropologist),
the scale is a method of classifying skin color on a global basis. Though the Von Luschan scale
was used extensively throughout the first half of the twentieth century in the study of race
and anthropometry, it was considered problematic, even by its practitioners, because it was very
inconsistent. In many instances, different investigators would give
different readings of the same person. It was largely abandoned by the early 1950s,
replaced instead by methods utilising reflectance spectrophotometry advocated by
anthropologists Professor Nina Jablonski and Dr George Chaplin.
Why Did Early Humans Migrating from Africa to Europe, Change Skin Colour?
First of all, Charles Darwin (Britain's most famous biologist) had already proven from his painstaking and careful observations on the
Ecuadoran Galapagos Islands, that all living things, plants and animals (i.e. flora and fauna) exposed
to brand new environments will slowly
evolve to adapt to that new environment, and the changes (mutations) will manifest itself via Natural Selection
to a majority of the new arrivals over thousands of years. This happens in particular on islands, because
on an island, in isolation from other parts of the world, new genetic changes will be isolated and evolve
independently with dramatic results.
Darwin noticed that in some of the bird species he observed on the Galapagos Islands,
their beaks had evolved to match the bird's
particular habitation on the island. Some birds had evolved long and narrow pointed beaks
because their food sources where in deep
hidden narrow places, while on the opposite side some birds had evolved shorter and wider beaks as their food
sources where not hidden but in the open.
Today the island of Madagascar is today's new Galapagos. It attracts lots of scientists who are amazed by the
wide diversity of amazing flora and fauna not found anywhere else in the world, such as Lemurs. Using DNA molecular
clocks, scientists say lemurs first arrived Madagascar from southeast Africa about 50 million years ago. At that time Arica was much closer to Madagascar compared to today.
Evolution is
seen in action by the types of different Lemurs living in different climates of the island.
Due to the Lemurs isolation on the island of Madagascar from other primates in Africa
for at least 40 million years, new genetic changes became isolated and evolved
independently in isolation. The Island of Socotra as well as Australia and New Zealand are other fine examples of island isolation and evolution, and new
species evolving in isolation, for example, where else can we find a Kangaroo, kiwi or a koala?
Speaking of koalas, because eucalyptus leaves (Eucalyptus microcorys) was the only food source available for tree-loving koalas in Australia in the beginning of their existence, evolution did something extraordinary.
Eucalyptus leaves are very poisonous, so after a few generations from the original koala ancestor getting very sick eating Eucalyptus leaves,
evolution equipped the digestive systems of
koalas with a way to detoxify the poisonous eucalyptus leaves before digestion. Eucalyptus leaves also provide koalas with water (which can be scarce during summer). But evolution is not perfect and a mistake was made with koala diet.
Although evolution allowed eucalyptus leaves to be detoxified in koala guts, there is a problem.
By itself eucalyptus leaves provide too little energy: Two hours of chewing eucalyptus leaves provides
just 10 minutes of energy!!
AND eucalyptus leaves diet requires a lot of energy just to digest it!!! It's a double whammy for the poor koala.
So to preserve the little energy obtained from eating just eucalyptus leaves, a koala must sleep
for at least 20 hours a day!
Why on earth evolution didn't allow koalas to
enjoy eating other stuff, so be able to get sufficient energy from different food sources,
is still a great mystery today, but we have to remember it's all about the environment: it is possible that the original koala ancestor was starving one day and had nothing to eat but abundant eucalyptus leaves (native to Australia). So evolution stepped in and allowed koalas to avoid starvation by being able to eat eucalyptus leaves. But somehow koalas were later on hard-wired to only eat eucalyptus leaves to this day. Just like Pandas, evolution thus made Koalas rather fussy eaters, preferring
just one type of food source; for pandas it is bamboo and only bamboo (even though scientists say Panda guts can digest meat just as in bears), for koalas it is eucalyptus leaves.
At least we now know why it is hard not to catch a koala having a nap on a tree... nzzzzzzzzzzzz.
Evolving to survive new environments, does not just happen in humans and animals. It also happens in plants, insects, yeasts and even in tiny bacteria.
For instance, when bacteria suddnly encounter an environment with antibiotics, they will slowly try to evolve to
adapt to the new environment: Natural Selection kicks in over time as the bacteria grows and divides over time, and will allow mutations that cause resistance to antibiotics to thrive, enabling some of the bacteria to survive in the new environment. This is Nature and Evolution in action,
always trying hard to make species survive new environments. Evolution in survival mode.
A 2015 episode of Mutant Planet, on Discovery TV, sums it all up: "if a mutation creates advantage, it will thrive, driving evolution"....
Mutant Planet is an exciting Discovery TV documentary series that reveals how the forces of nature through sheer power of evolution and natural selection
shaped life in all it's unexpected and glorious forms, and filled our lovely planet with an amazing diversity of plants and animals including humans.
Reason For Different Skin Colours in Humans Today
Early Humans migrating from Africa to Europe were no exception to the survival mode of evolution. The main reason why humans migrating to Eurasia evolved to produce less melanin
leading to less skin colour, was because low levels of pigmentation can absorb more sunlight (ultra-violet radiation)
in colder climates. Evolution is all about species survival, and species (plant or animals) will evolve new traits in order to survive brand new environments.
Thousands of years ago, the need to absorb sunlight (ultra-violet radiation) WAS very essential for the production of vitamin D
in the human body. It is not an issue today, but it was thousands of years ago when human diet had inadequate amounts of Vitamin D in their diet.
Thus the further north into Europe and Asia, ancient people migrated, the lesser their
skin pigmentation became, in order to be able to absorb as much sunlight (ultra-violet radiation) as possible. A very simple answer to
give a small curious child if he or she asks an adult, why people come in different colours!!
It is genes in the cell's nucleus that determine ethnic group, and not the genes in the mitochondria DNA (MtDNA) or Y-Chromosome DNA (Y-DNA).
While MtDNA and Y-DNA genes tell us when and where exactly different ethnic groups emerged around the world at different points in time via
migration out of Africa, for each point where a different MtDNA or Y-DNA marker arose (due to mutations in MtDNA or Y-DNA), we can say with certainty
that a corresponding mutation in nuclear DNA may have occurred, leading to a specific genetic trait.
For instance the genes that control skin colour, via regulating the production of melanin, are only found in the nucleus at chromosomes 15 and 16.
MtDNA and Y-DNA tells us that about 70,000 years ago once ancient humans left Africa and entered Yemen, a mutation occurred leading to a different MtDNA or Y-DNA marker.
Thus likewise 70,000 years ago a mutation occurred in the nuclear DNA (at chromosomes 15 and 16) that led to a specific genetic trait:
different skin colour pigmentation. In all human cells, chromosome 15, 16 and 19 in the nucleus determines skin, hair and eye colour. Among the genes that determine
skin and eye colour found on these chromosomes are : OCA2 gene AND the HERC2 gene which both determine eye colour (chromosome 15 );
SLC24A5 gene responsible for light skin colour (chromosome 15) and MC1R gene or (the melanocortin 1 receptor gene) that
produces brown to dark skin colour or high levels of Melanin (chromosome 16); and the HLC1 gene at chromosome 19 which determines hair colour. Clearly once modern humans reached Asia proper (60,000 years ago) and
Europe proper (45,000 years ago), mutations suddenly occurred on these genes, influenced by environmental factors such as sudden
decrease in intensity of sunlight and ultra-violet radiation, changes in temperature, atmospheric pressure and humidity. Different types of foods, fruits etc available in new regions of the
world, as ancient humans migrated out of Africa, also played a role too in gene mutations, since brand new chemicals in new food, (not eaten before by ancient humans in Africa)
can trigger mutations over time as evolution gets to work, trying to make the new ancient human migrants adapt to their new environments.
BREAKING NEWS:
In February 2018, British scientists at University College London and the Natural History Museum London were able to analyse
the genome (for genetic markers like SNPs, discussed in Section E) of the famous 10,000 year old Ceddar Man fossils discovered
at Gough's Cave in
Somerset (discussed in detail in Section I) and made an important discovery: SNPs for the genes that give dark skin colour in
modern humans i.e. the MC1R gene, were found in Cheddar Man's genome. Instead of finding only SNPs for SLC24A5 genes on chromosome 15 and no SNPs for MC1R genes on chromosome
16 on Cheddar Man's decoded genome, they found SNPs for MC1R genes instead on chromosome 16 and no SNPs for SLC24A5 genes on chromosome 15. This suggests the SLC24A5 gene that
gives light skin colour in modern humans may have only appeared in some migrants to Europe
after at least 10,000 years ago, and not before 10,000 years ago in migrants into Europe. Recall that modern humans arrived Europe roughly 45,000 years ago. This also means that
while evolution got to work enabling lighter skin colour to be manifested in modern humans migrating from Africa to Europe, not all the migrants had
lighter skin colour changes to
enable the skin absorb more sunlight to make vitamin D in cold climates. Some early modern humans arrived modern Europe with darker skins colours
(as supported by the Cheddar Man discoveries in February 2018).
But Natural Selection was the reason why all the remaining darker skin ancient human migrants in Europe had lighter skin colour eventually.
Today the MC1R gene remains inactive in modern day Europeans (i.e. European ancestry) on chromosome 16 due to a permanent mutation, meanwhile
active variants of the SLC24A5 genes are found on chromosome 15 in modern day Europeans (i.e. European ancestry). But an analogy of the MC1R gene presents itself when modern Europeans
visit hot tropical climates for holidays such as Brazil or North Africa and get a temporary skin tan. The skin tan is not due to the inactive MC1R gene being reactivated but simply the exposure to longer periods
of the sun in hotter tropical climates directly causing melanin genes in skin cells to produce large amounts of melanin.
Survival mode of evolution in humans is the reason why: Inuits (Eskimos) and Aleuts are much better prepared in
surviving the harsh perpetual cold weather of the arctic regions than anyone else; evolutionary adaptation to living in high altitudes (i.e. human tolerance to hypoxia)
is evident in residents of many towns in Chile, Peru and Bolivia such as La Rinconada;
Ethiopians, Kenyans and Eritreans keep winning long distance races like marathons like their ancestors did; we have Lactose Tolerant people mostly in Europe, where huge amounts of diary products are consumed on a daily basis etc. In each
and every one of these examples the logic holds true: if a mutation in humans creates advantage, it will thrive, driving evolution.
However we are not talking about the mutant X-Men here!!
NEW UPDATED DATA
The Case for Europe
In the case of Europe, about 70,000 years ago, after modern humans spread from Africa, one group moved north and came to populate Europe (as well as north, west and central Asia).
The first anatomically modern humans arrived in the Europe circa 45,000 years ago. These were the Palaeolithic hunter-gatherers sometimes called the Cro-Magnons. They populated Europe sparsely and lived a lifestyle not very different from that of the Neanderthals they replaced and who later became extinct circa 39,000 years ago. Mesolithic Europe covers 12,000 to 6,000 years ago. Cro-Magnons are the earliest known form of anatomically modern humans found in Europe, dating from about 35,000 to 45,000 years ago.
The first Cro-Magnon thus arrived 45,000 years ago.
Another second migration of Homo sapiens into Europe, took place circa 35,000 to 10,000 years ago and replaced most earlier Cro-Magnon populations.
Then something revolutionary happened 10,000 years ago in the Middle East known as the Fertile Crescent: farming was invented, which allowed for enormous population growth. We know that from around 8,000 years ago a wave of farming and population growth exploded into Europe from migrants passing through Turkey (the Start of Neolithic Europe is about 6,000 years ago). Today their descendants are still there and are recognisable by some very distinctive characteristics: light skin, a range of eye and hair colours and nearly all could happily drink milk (Lactose Tolerant). Before 8000 years ago, hunter-gatherers in Europe could not digest the sugars in milk (were Lactose Intolerant). Only after the arrival of new waves of neolithic farmers (bring along farming culture) did the mutation for Lactose Tolerance arise. Also modern Europeans do not look much like those of 8000 years ago, i.e. had darker pigmentation.
However, exactly when and where these characteristics came together has been guesstimated, until the Jobling and Batini et al research work in 2015.
provided compelling answers at 84th annual meeting of the American Association of Physical Anthropologists.
Back in Section E of this eBook we learnt through the enjoyable book, The Seven Daughters of Eve that the ancestry of 99% of
all Europeans can now be traced back to just seven women. In May 2015, scientists at the University of Copenhagen and the University of Leicester in Britain (led by Professor Mark Jobling and Dr Chiara Batini) have uncovered a more stunning fact: Most European men descended from just three male ancestors (from the Bronze Age period, 6,000 years ago). Unlike Professor Bryan Sykes who used MtDNA for his discoveries, the University of Leicester scientists used the other type of marker known as Y-Chromosome DNA. The most common Y-Chromosome DNA haplogroup in Europe is the R haplogroup representing over 75% of the native population of Europe. The R haplogroup itself is composed of smaller sub-haplogroups such as: R1b (Western Europe) and R1a (Central and Eastern Europe). The next most common haplogroup in Europe is the I haplogroup, it is one of the oldest Y-Chromosome DNA Haplogroups in Europe and associated with the ancient European Gravettian Culture).
The sub-haplogroup of the I haplogroup such as I2 and I1 covers 10% of European population, but it is particularly found in larger frequencies in Scandinavia (Iceland, Norway, Denmark and Sweden). What the University of Leicester scientists discovered was that, three distinct mutations occurred in 63% of the 700 male volunteers they tested. The mutations were found in the R1a, R1b and I1 haplogroups. Clearly back in Bronze Age Europe, 6,000 years ago, three ancient men (Proto-Indo-Europeans, and each one carrying the R1a, R1b and I1 markers) and postulated to be the Yamnaya (or Kurgan), are the ancestors of over half of European males today and mutations in these three men (i.e. the genotypes) all had three phenotype similarities: they all had light skin, a range of eye and
hair colours and nearly all can happily drink milk. Another lasting legacy was that these three men brought along a Proto-Indo-European language which has evolved into 99% of all the more than 150 languages and dialects spoken today all over Europe. You can read more about the specific genes that govern eye and skin colour later on below (look for the sub-heading: detailed look at some important genes determining human skin, eyes and hair colour pigmentation).
Link to research works done by
scientists at the University of Leicester in Britain (led by Professor Mark Jobling and Dr Chiara Batini) and University of Copenhagen are from the sources below:.
Large-scale recent expansion of European patrilineages shown by population resequencing
Nature Magazine, 19 May 2015.
Population genomics of Bronze Age Eurasia
Nature Magazine, 11 June 2015.
DNA data explosion lights up the Bronze Age
Nature Magazine, 11 June 2015.
Today a lot more blond people are found in colder
places like northern Germany, Scandinavia and northern Russia.
Meanwhile southern Europeans of Spain, Portugal, Italy (and Sicily) and Greece,
have slightly more pigmentation in the skin,
since these places have more hotter days with lots of sunshine per year compared to northern Europe.
Thus approximately up to 70,000 years ago, all human ancestors (archaic
Homo sapiens ) had brown to dark skin colour (due to the hot climate of Africa at that time). But about
40,000 to 65,000 years ago, a lighter skin colour began to evolve, when the first modern humans moved from Africa
to much colder climates in Eurasia which had much less sunlight per day at that time.
Sunlight is not the only reason why people have different skin pigmentation around the world today.
Early ancestry also plays a part too. A second reason why southern Dravidian Indians have darker skin pigmentation
compared to
northern Indians, apart from the fact that southern India is closer to the equator,
was because modern humans first arrived the southern parts of India (from Africa) from 65,000 years ago
en-route to Australia to evolve into the Aboriginals. Southern Dravidian Indians were thus the first
inhabitants of ancient prehistoric India, before other migrations of early humans into India from the north, leading up to the
Indo-Europeans (or Aryans) who appeared thousands of years later, first entering into northern India.
Professor Spencer Wells (Cornell University), in his fascinating book:
The Journey of Man: A Genetic Odyssey identified an important single genetic marker (i.e.SNP marker) on the
Y-Chromosome DNA,
linking the first southern Dravidian Indians
to the first Aboriginals in Australia, about 48,000 years ago. This marker is part of the ancient M130 mutation discussed earlier on
Y-chromosome haplogroups. Today both
Aborigines and Dravidian Indians share the M130 mutation in their Y-Chromosome DNA. The M130 mutation
was discussed earlier on in great detail at the entertaining genetics tutorial section of this ebook.
Human Genetic Variations Today
Today all human MtDNA now show an average of about 50
mutations which have occurred in the 200,000 years
(i.e since Mitochondrial Eve). Some geneticists say that in total it is 120 mutations, not 50 mutations.
Thus the maximum number of MtDNA differences between all humans is 50 (or 120 as other scientists say).
Put in another way, during those 200,000 years modern humans
have gradually but steadily accumulated a maximum of 50 variations in their MtDNA.
The oldest humans, the San natives of South Africa's Kalahari Desert and the Mbo natives of Cameroon,
have the most up to 50 (120), and all other human ethnic groups around the world have fewer.
Humanity's 50 genetic variations have been divided into 36 subunits known as MtDNA haplogroups.
discussed earlier on in this ebook.
About half of the MtDNA mutations appear to have occurred in approximately
the last 70,000 years, that is after the migration out of Africa.
That over a half of the mutations took place in Africa, shows how old African MtDNA is.
There is another way to look at humanity's amazing 50 genetic variations:
Having just 50 genetic variations in 200,000 years means that humans have very little genetic
diversity today.
According to the American Journal of Human Genetics (June 2003)
the grounds for the fact that the population of modern human species was at one time drastically
reduced, (70,000 years ago, there were just 10,000 humans), comes from the fact that all humans
have virtually identical DNA, i.e. humans are genetically highly homogenous
(this compares with other mammals like bears which show far greater genetic diversity).
In fact, much greater genetic diversity exists between a small population of chimpanzees in one location
than all of humans around the world.
This is because geneticists tell us that all humans are about 99.9% identical, and
thus differ by just 0.1 % in their DNA (leading to such diversities such as the human ethnic groups).
0.1% is a huge number in cellular genetics. 0.1% of the 70,000 genes in the human genome are 70 genes.
It is these 70 genes that make ethnic groups Europeans, Africans and Asians different from one another in physical appearance ON THE OUTSIDE.
These 70 genes among other things handle skin colour, eye colour, hair texture etc, as well
as very specific features that make it possible to do such things as a DNA test to prove whose
DNA, a blood or saliva sample belongs to, as evident in forensic science.
Since all humans have 3 billion nucleotide base pairs in their genome, we can also state the
fact that 99.9% of our 3 billion base pairs are the same in all people,
with 0.1% (3 million) being different because of genetic drift, mutations, natural selection, etc.
When and How Did We know That 99.9% of Humans are Identical on a Genetic Level?
When the $2.7 billion Human Genome Project had been completed officially in April 2003 it showed one
surprising fact: Any two unrelated people are 99.9 percent identical at the genetic level.
Ex-president Bill Clinton who was president of the U.S. when the $2.7 billion Human Genome Project first began in 1993,
also acknowledged in 2000 (when a draft of the project was announced)
that "All human beings, regardless of race, are 99.9 percent the same".
Anthropologists Professor Nina Jablonski and Dr George Chaplin both
did several research projects on human skin colour
that concluded that all human skin colours are not due to race but adaptation to life under the sun.
In other words, race is only skin deep.
Dr Nina G. Jablonski is an American anthropologist
and palaeobiologist, known for her research into the evolution of skin color in humans. One of
her popular and amazing books on this subject is:
Living Color: The Biological and Social Meaning of Skin Color published in 2012, by University of California Press. The book investigates the social history of skin color from prehistory to the present,
showing how our body's most visible feature influences our social interactions in profound and complex ways.
One of the important implications of Jablonski and Chaplin's work
is that it underlines the emerging fact about concept of race as purely a social construct, with no scientific merits (in other words race is a social concept, not a scientific one). However the word "race" is not going to walk away in the modern world, it will continue to confuse us for generations to come, even though DNA research has shown that genetically all humans, regardless of skin color and other
surface distinctions, are basically the same 99.9%. The fact that just 70 genes separates one human from another, shows why humans today,
have very little genetic diversity.
A Question of Race: when the word "race" was invented a long time ago, we did not know much about our DNA. Today we now
know so much about our DNA and so the word "race" is kinda invalid. "Ethnic groups" is a much better term today.
As noted earlier on, just 70 genes make the various ethnic groups in Europe,
Africa and Asia different from one another in physical appearance ON THE OUTSIDE.
You can read more about the basics of human genetic and physical variations here:
Understanding Human Variations
I also strongly
recommend buying or borrowing the fascinating book by Dr Nina G. Jablonski mentioned above for more understanding of human skin colour variations.
Why are Polar Bears and Brown Bears in Different Colours?
As an analogy, polar bears (Ursus maritimus) in colder Arctic north western Alaska
and Canada are white, compared to brown bears (Ursus arctos) in warmer parts of southern Alaska and Canada.
Both are two different species of bears.
Scientists explained this by discovering that polar bears had originally descended from brown bears (as one single species):
When brown bears moved to the Arctic looking for food in times of heavy prolonged draught in the warmer areas, over
130,000 years ago, they eventually evolved into a new species: polar bears, to adapt to
their new surroundings environment and climate, via evolution and natural selection, e.g. by developing white fur
that would help them blend in with the harsh, white Arctic ice. Can you imagine what would have happened
if a polar bear was still black or brown in colour and wanted to catch prey without a natural white camouflage?
However polar bears and brown bears are two different species
because there is very high genetic diversity between the two, BUT a polar bear can mate with a brown bear to
produce hybrid offsprings that are ok and can reproduce later in life. How come?
Well normally cellular genetics dictates that
in 95% of most cases
if two different species of animals mate, then there is either no pregnancy or nothing happens,
or the foetus is stillborn or
offsprings are sterile. The reason being that the genomes
of the two different species are incompatible at the cellular genetic level.
However there is ONE exception to this rule: the remaining 5% of the above statement is due to the fact that if there is a closer
most recent common ancestor, THEN two different species of animals can mate to produce normal offsprings.
Brown bears and polar bears
evolved from a common ancestor about 150,000 years ago (a short period of time in development of speciation).
In contrast donkeys and horses diverged from a common ancestor more than 2 million years ago (a very long period, sufficient for
speciation to show up very huge genetic differences). While brown and polar bears can mate to produce normal offsprings,
donkeys and horses cannot mate successfully: at a genetic level, horses have
64 chromosomes but donkeys have 62 chromosomes! so if both mated their chromosomes will not pair up properly,
inhibiting meiosis (or the ability to make sperm or egg cells) in their offsprings, and the reason why mules are always sterile. Zoos have also been able
to crossbreed female tigers and lions (called LIGERS) since both share
a common recent ancestor.
But zoos find difficulty crossbreeding cheetahs and leopards, as both do not share a common recent ancestor,
although both share 38 chromosomes!
Likewise you cannot crossbreed a hippo with a rhino, since both do not share a common recent ancestor. One well known crossbreeds (via artificial selection) are the various varieties of dogs:
despite the fact dog sizes range from tiny cute Chihuahuas to giant Mastiffs, St. Bernard and Kuvasz,
all dogs share a common wolf ancestor just 12,000 years ago AND all dogs have 39 pairs of chromosomes Thus crossbreeding of dogs is very easy
and widespread (just one major gene, the Sonic hedgehog gene is responsible for the size and shape of the legs in all dogs, so this gene is easily manipulated in crossbreeding programmes).
Did You Know That?
While it is beyond any doubt that all dogs share a common wolf ancestor just 12,000 years ago, there is one big major difference between the two:
While wolfs can still eat huge amounts of raw meat (flesh) on a daily basis, the domesticated dog just can't however. This is because,
during the early days of domestication, dogs were given lots of cooked food (including cooked meat) by humans, and over thousands of years, evolution
and Natural Selection has gradually switched off a majority of the genes that made enzymes capable of digesting raw meat in dogs!!! The end result today is that,
while todays dogs can still eat small moderate amounts of raw meat, given them too much raw meat
will simply overwhelm their stomachs, since this organ is now hard-wired to digest only cooked meat!!
Today along with familiar dog breeds — the labradors, bulldogs, spaniels and retrievers — dozens of new crossbreeds have appeared,
from chorkies (a chihuahua and yorkshire terrier mix) to maltipoos (maltese and poodle) and muggins (miniature pinscher and pug).
Recall that humans and chimpanzees diverged from a common ancestor circa 7 million years ago,
so humans and chimpanzees are of course two
very different species (humans have 46 chromosomes, but chimps have 48 chromosomes). Despite the many different ethnic groups today around the world,
all humans have very little genetic diversity as explained previously, (i.e. humans are 99.9% identical at molecular genetics level, i.e. DNA is 99.9% identical),
and so grouped in a single species. As explained earlier on in this ebook, all humans diverged from common ancestor about 200,000 years ago in Africa (a short period of time in development of speciation).
The Shape of the Human Nose is a Cold Weather Adaptation from the Last Ice Age
Around 70,000 years ago, the narrower noses of modern
humans in Europe and parts of Asia (e.g. Middle East, western and easter Asia, Siberia etc) evolved to
allow cold air
breathed in to be made warmer, before reaching the temperature-sensitive lungs, as it was painful for Homo sapiens sapiens
at that time to breathe in very cold air in colder climates. This cold weather adaptation trait
was seen earlier in the
Neanderthals,
because they were the first ancient humans to experience severe cold weather i.e during the last Ice Age.
Careful reconstruction of Neanderthal faces from fossils, show that their noses
were well adapted to allow Neanderthals to make very cold air warmer, before it reached the sensitive lungs.
Geneticists calculate that about 30 or so genes help model the shapes of our faces, noses,
eyes out. The genetics of human skin, eye and hair colour etc is so advanced today, that hundreds of entire textbooks
running into
hundreds of pages has been published and an advanced knowledge of genetics is needed to understand it.
Scientists Study The Shape Of The Nose And Its Relationship With Cold Climates
The Shape of a Nose:
Cold-weather noses may function differently from those that evolved in hot and humid climates
Scientific American magazine, August 26, 2011.
BBC Science report: Scientists Study Colour of the Skin And Its Relationship With Cold Climates
Molecular Genetics of Human Pigmentation Diversity
Human Molecular Genetics, Volume 18, 2014.
This article is explained in detail below at the section looking at genes determining skin pigmentation.
Five books provide fascinating genetics-derived details about how the three main human ethnic group
(Africans, Asians and Europeans) emerged:
A Troublesome Inheritance: Genes, Race and Human History by Nicholas Wade is one good example.
It was published in 2014, hence very recent.
Chapters 3, 4, 5, 6 and 7 of the book are good starting points.
What's in Your Genes? by Katie McKissick, published in 2014 (recent as well).
The other book is the popular Genes, Peoples and Languages by
Professor Emeritus Luigi Luca Cavalli-Sforza, published in 2001 and his other earlier book
The History and Geography of Human Genes published in 1994.
Human Evolutionary Genetics by Professor Mark Jobling, Dr Edward Hollox et al.
published in 2013, provides a much more detailed explanation of how genes work in general.
What is Melanin?
Melanin is a complex protein molecule produced by specialised skin cells known as Melanocytes. Melanin is a brown pigment. Melanosomes are the very places in the cell cytoplasm storing melanin produced by melanocytes. Actually the melanocytes make two forms of melanin: eumelanin and pheomelanin.
The relative amounts of these two pigments help determine the colour of a person's hair and skin. In the eyes, melanin is not manufactured continuously like in skin and hair. When a mutation occurs in the
enzymes that make melanin, its leads to albinism. Several groups of people in East and West Africa
show this mutation, by having skin, hair (which is blond) and eye colour that is very light.
The only time
the melanin gene is universally switched off in all humans regardless of ethnicity, occurs naturally as we age and hair colour turns white, as all the skin cells producing the hair protein (Keratin) no longer produce melanin to colour it.
DETAILED LOOK AT SOME IMPORTANT GENES DETERMINING HUMAN SKIN, EYES AND HAIR COLOUR PIGMENTATION
It is important to Remember, after getting this far in this ebook, that it is actually genes in the cell's nucleus that determine ethnicity, and not the genes in the mitochondria. For instance the genes that control skin colour, via regulating the production of melanin, are only found in the nucleus.
There are several major skin pigmentation genes (roughly about 7 major genes in total).
In the book A Troublesome Inheritance: Genes, Race and Human History by Nicholas Wade,
first was published in 2014,
Chapters 4, 5, 6 and 7 of the book reveal some interesting details about some of the
genes that determine ethnic groups.
The SLC24A5 and SLC245A2 genes
Two of the 7 genes that determine skin colour are the SLC24A5
and the SLC245A2 genes, both producing light skin pigmentation or low levels of Melanin. The SLC24A5 is located on chromosome 15.
These genes are expressed in almost 98% percent of Europeans, 70% of Middle East people, 75% of Asians
and 60% of
people living in the northern parts of the Indian Subcontinent, among other places. But the genes are not
expressed in Sub-Saharan Africans who also have the genes (a different version of the genes).
However these light skin colour genes are expressed in the hands (palms) and feet (the soles)
of most Sub-Saharan Africans! explaining why the soles and palms are lighter coloured. Other genes determing or playing a role in skin colour
include the ASIP, IRF4, SLC24A4, TPCN2, TYR, and TYRP1 genes.
The MC1R gene
Meanwhile
another major gene is the MC1R gene or (the melanocortin 1 receptor gene) that produces brown to dark skin or high levels of
Melanin. The MC1R gene is located on the long (q) arm of chromosome 16 at position 24.3.
More precisely, the MC1R gene is located from base pair 88,512,526 to base pair 88,514,885 on chromosome 16. All human chromosomes have 2 arms -- a short arm and a long arm -- that are separated from each other only by the centromere, the point at which the chromosome is attached to the spindle during cell division. By international convention, the short arm is termed the "p arm" while the long arm of the chromosome is termed the "q arm"
The MC1R gene is expressed in almost 97% percent of Sub-Saharan Africans, 5% of Middle Eastern people and 65% of
people living in southern parts of
Indian Subcontinent and Sri Lanka, as well as Melanesians in the Pacific Ocean, among other places.
Although the gene is not expressed in Europeans and most west Asians who also possess a
different version of MC1R gene,
the gene IS expressed
in the cells that make hair colour, explaining why hair colour of southern Europeans (e.g. Greece),
as well as those in the Middle East and West and East Asia (China, Japan etc)
is darker compared to the natural light or honey brown hair colour of northern Europeans, such as Scandinavians and Russians. The HLC1 gene at chromosome 19 also determines hair colour.
As mentioned earlier on,
the only time
the melanin gene is universally switched off in all humans regardless of ethnicity, occurs naturally as we age and hair colour turns white, as all the skin cells producing the hair protein (Keratin) no longer produce melanin to colour it.
According to Dr Alan Rodgers, the MC1R gene (which affects both skin and hair colour), shows evidence for positive
selection in Sub-Saharan
Africans sometime
between 200,000 and 1 million years ago. Source:
Genetic Variation at the MC1R Locus
and the Time Since Loss of Human Body Hair, Alan R. Rogers, David Iltis, and Stephen Wooding, Current Anthropology
Vol. 45, No. 1 (February 2004), pp. 105-108.
Dr Alan Rodgers findings thus supports the notion earlier on in this ebook that
approximately 1 million years ago years ago, all human ancestors up to archaic Homo Sapiens
had dark skin colour (due to the hot climate of Africa). But about
70,000 years ago, a lighter skin colour evolved when the first modern humans migrated from Africa
to colder climates in northern Eurasia which had much less sunlight per day at that time.
In other words the MC1R gene was switched off at some point in time from 70,000 years ago for those migrating away from Africa to Europe and Asia.
BREAKING NEWS:
In February 2018, British scientists at University College London and the Natural History Museum London were able to analyse
the genome (for genetic markers like SNPs, discussed in Section E) of the famous 10,000 year old Ceddar Man fossils discovered
at Gough's Cave in
Somerset (discussed in detail in Section I) and made an important discovery: SNPs for the genes that give dark skin colour in
modern humans i.e. the MC1R gene, were found in Cheddar Man's genome. Instead of finding only SNPs for SLC24A5 genes on chromosome 15 and no SNPs for MC1R genes on chromosome
16 on Cheddar Man's decoded genome, they found SNPs for MC1R genes instead on chromosome 16 and no SNPs for SLC24A5 genes on chromosome 15. This suggests the SLC24A5 gene that
gives light skin colour in modern humans may have only appeared in some migrants to Europe
after at least 10,000 years ago, and not before 10,000 years ago in migrants into Europe. Recall that modern humans arrived Europe roughly 45,000 years ago. This also means that
while evolution got to work enabling lighter skin colour to be manifested in modern humans migrating from Africa to Europe, not all the migrants had
lighter skin colour changes to
enable the skin absorb more sunlight to make vitamin D in cold climates. Some early modern humans arrived modern Europe with darker skins colours
(as supported by the Cheddar Man discoveries in February 2018).
But Natural Selection was the reason why all the remaining darker skin ancient human migrants in Europe had lighter skin colour eventually.
Today the MC1R gene remains inactive in modern day Europeans (i.e. European ancestry) on chromosome 16 due to a permanent mutation, meanwhile
active variants of the SLC24A5 genes are found on chromosome 15 in modern day Europeans (i.e. European ancestry). But an analogy of the MC1R gene presents itself when modern Europeans
visit hot tropical climates for holidays such as Brazil or North Africa and get a temporary skin tan. The skin tan is not due to the inactive MC1R gene being reactivated but simply the exposure to longer periods
of the sun in hotter tropical climates directly causing melanin genes in skin cells to produce large amounts of melanin.
The OCA2 gene
Another interesting human gene known as OCA2, controls the colour of the eyes (blue, brown, hazel, green etc, in general, brown is the most common eye colour, followed by blue, grey and then green). Human eyes are fascinating - just take a look at the many different shades of eye colour and the intricate, unique iris patterns from all over the world. What we call eye colour is actually the colour of the part of the eye known as the iris.
But the expression of OCA2 gene largely depends on the levels of melanin in the eyes (produced by the other genes mentioned before above), very little melanin in skin cells then
blue eyes normally results (the reason why blondes are mostly blue-eyed). More than average Melanin, then brown or dark brown eyes results,
depending on Melanin content, in other words: eye colour is tied to hair and skin colours. The OCA2 gene has a well known location on the chromosome 15 in
all humans: The OCA2 gene is located on the long (q) arm of chromosome 15 between positions 11.2 and 12.
More precisely, the OCA2 gene is located from base pair 25,673,627 to base pair 26,018,060 on chromosome 15. It is easy to find and study by geneticists.
NEW UPDATED DATA
Chromosome 15, 16 and 19 and Skin and Eye Colour
In 2013, African-American molecular biologist, Dr Rick Kittles submitted his DNA to 23andMe for an Autosomal DNA (atDNA) ancestry test.
Days later the DNA test revealed the results of Autosomal DNA on his 22
autosomal chromosomes (i.e chromosome pairs 1 to 22). It showed that apart from his 80% African ancestry,
Dr Rick Kittles also had 12% European ancestry and 8% Native Indian ancestry in his genome.
Had his DNA test also included MtDNA and/or Y-DNA tests, it would have indicated which European and African
nations contributed to his African and European ancestries.
You will notice in the above diagram, that chromosome 15 in Dr Rick Kittles autosomal DNA is 99% African. A geneticist who did not know who Dr Rick Kittles was,
could by looking at
genes on chromosome 15, estimate his ancestry: Chromosome 15, 16 and 19 are the location of important genes that determine eye and skin pigmentation, such as the
OCA2 gene AND the HERC2 gene, on chromosome 15, which both determine eye colour and the SLC24A5 gene responsible for light skin colour. Meanwhile
another major gene is the MC1R gene or (the melanocortin 1 receptor gene) that produces brown to dark skin colour
or high levels of Melanin. The MC1R gene is located on chromosome 16. The HCL gene (responsible for hair colour) is located on chromosome 19.
This Link Explains DNA Tests That Identify Ancestry.
In addition to colour, the fibrous tissue in the iris also forms a unique pattern in every individual. Thus just like fingerprints, an iris pattern can be used for biometric identification. Some banks now use iris scans, instead of pin codes for identification and some countries are now using iris scans for border control purposes. For example, United Arab Emirates (UAE) has been operating an iris scan system since 2001 at all ports of entry to screen for expellees.
Why are There More People With Brown Coloured Eyes Than Blue or Green Eyes?
All humans normally has two forms of a gene or pairs of the same genes. These are called alleles. In pairs of alleles, one is usually more dominant and gets expressed over the recessive one. In 1907, both Charles and Gertrude Davenport (U.S. geneticists) discovered that
brown eye colour is always dominant to blue or green eye colour.
So most humans have brown or hazel coloured eyes.
Originally humans around the world, all had only brown eyes, but a genetic mutation affecting the OCA2 gene
resulted in the creation of a "switch," which literally "turned off" the ability to produce brown eyes.
The OCA2 gene codes for the so-called P protein, which is involved in the production of melanin.
The "switch," which is located in the gene adjacent to OCA2 does not, however, turn off the gene entirely,
but rather limits its action to reducing the production of melanin in the iris -- effectively "diluting" brown eyes to blue.
The switch's effect on OCA2 is very specific therefore, if the OCA2 gene had been completely destroyed or turned off, all
human beings would be without melanin in their hair, eyes or skin colour, a condition known as albinism.
Scientists have identified three different changes in the OCA2 gene that also contributed to blue eyes. The HERC2 gene regulates the OCA2 gene expression. In places like Scandinavia, a common polymorphism in HERC2 gene (the SNP loci rs1129038 and rs12913832 in the HERC2 gene) is responsible for the blue eye phenotype. A person who has two copies of C allele at HERC2 rs1293832 will likely have blue eyes while homozygous TT predicts likely brown eyes. New research shows that all people with blue eyes today,
have a single, common ancestor. Scientists have tracked down a genetic mutation which took place 6,000-10,000 years ago and is the
cause of the eye color of all blue-eyed humans today.
Read more on eye colour genetics at:
A Three Single Nucleotide Polymorphism Haplotype in Intron 1 of OCA2 Explains Most Human Eye Color Variation.
David Duffy and Wei Chen et al. American Journal of Human Genetics. 2007 February; 80(2): 241-252.
(http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1785344)
The gene mutation for blue eyes is expressed in many places of the world (aside from
mostly in Scandinavia were a high frequency of the mutation exists), such as Turkey, Syria, India, China and Africa.
The photo below shows a young girl with African ancestry with blue eyes.
Alleles and Mixed Ethnic Groups Offsprings
If a person with African heritage, has offsprings with a person from European heritage,
the offsprings will have not have both full alleles of the skin colour genes (e.g. MC1R and SLC24A5).
But one half each or hybrids.
Recall that a person normally has two forms of a gene or pairs of the same genes.
These are called alleles i.e. MC1R-MC1R or SLC24A5-SLC24A5. However both pairs may not be
exactly 100% similar, there are small variations.
Thus in pairs of alleles, one is usually more dominant and gets
expressed over the recessive one. If a person does indeed have identical versions of a gene,
then that person is
homozygous for the gene. If the person does not have identical versions of the same gene
then that person is heterozygous for that gene. In genetics, lower case letters are used for recessive genes and capital letters for dominant genes, e.g.
MC1R-mc1r and SLC24A5-slc24a5. Each parent donates one of the pairs of genes. So for example both parents can
either donate dominate alleles or both donate recessive alleles, or one parent donates either a recessive or dominant allele. In any genetics text book, the story of how one Gregor Mendel, a Victorian-era German monk (not a scientist) discovered that
genes come in pairs of alleles (dominant and recessive types), makes fascinating reading. Gregor Mendel went on to become the father of modern genetics.
A mixed race person will not have
full alleles of either the genes (MC1R-MC1R and SLC24A5-SLC24A5), but a hybrid or MC1R-SLC24A5,
and in many cases the dominant part of the hybrid is usually SLC24A5, hence mixed race offsprings
usually have lighter pigmentation (i.e SLC24A5-mc1r). If the dominant gene in the
hybrid MC1R-SLC24A5 is MC1R, then the mixed race offsprings
will have darker pigmentation (i.e slc24a5-MC1R). Sometimes there is a 3rd or 4th version of a gene (not just two versions),
these versions are mutations or faulty versions of a normal gene, however some faulty genes
are beneficial.
Molecular Genetics of Human Pigmentation Diversity
Human Molecular Genetics, Volume 18, 2014. This interesting article explains more about the MC1R, SLC24A5 and other genes
that determine hair and skin colour in humans.
NEW UPDATED DATA
What is Albinism?
When the genes that produce Melanin in any quantity, are not expressed properly,
(due to a mutation in its amino acid arrangement, caused by mutation in genes such as TYR)
then it leads to the rare instances of Albino populations or complete absence
of melanin in the skin, eyes and hair. The TYR gene provides instructions for making an enzyme called tyrosinase.
This enzyme is located in melanocytes, which are specialized cells that produce a pigment called melanin.
As explained earlier on, melanin is the substance that gives skin, hair, and eyes their color. Melanin is also found in the light-sensitive
tissue at the back of the eye (the retina), where it plays a role in normal vision.
Tyrosinase is responsible for the first step in melanin production. It converts a protein building block (i.e. amino acid) called
tyrosine to another biochemical called dopaquinone. A series of additional chemical reactions convert dopaquinone to melanin in the skin,
hair follicles, the colored part of the eye (the iris), and the retina. If a bad mutation occurs in the TYR gene, it will lead to albinism.
This mutation is present in several parts of Africa
(in particular Tanzania where one in 1,400 is an albino, meaning the albinism gene is carried by a
significant population in Tanzania, scientists think a mutation about 5,000 years caused a large proportion of Tanzanians to be albino. Just as dark skin colour causes negative prejudice for people of African ancestry in Europe and elsewhere, within African populations themselves there is horrific negative prejudice for Albino people in Tanzania. That some humans all over the world today are particularly obsessed with skin colour is an understatement!
A group of happy Albino Tanzanian school kids with non-Albino Tanzanian kids. There is no negative prejudice for Albinos at a young age: all Tanzanian kids and teenagers treat everyone including Albinos as good friends and enjoy each others company. Sadly only at the onset of adulthood does some form of negative prejudice begin to manifest due to the colour of the skin of Albinos. But just a very small proportion of stupid adult Tanzanians show this negative prejudice towards Albinos, the majority of the population see Albinos as one of them, and the government in Tanzania is
working hard to protect all Albinos in Tanzania..
There is no remedy for Albinism, however offsprings of Albinos, may have skin pigmentation (i.e. no Albinism) if one of the parents does not have the albino mutation (or faulty melanin gene), as the Albino gene is a recessive trait and like Sickle Cell Anaemia, a new born baby only has albinism if BOTH parents carry the albinism gene.
Remember a gene is a recipe for making specific proteins (hundreds or thousands of amino acids in a particular sequence).
Making melanin (a protein) requires lots of enzymes (also proteins). A mutation (a mistake nucleotide base pair arrangement in genes, which the leads to a mistake in the amino acid sequence of a protein) can happen in the genes coding for ANY one of the enzymes involved in making melanin.
Later Modern Humans as already discussed first left Africa 70,000 years ago or thereabouts. Once they
crossed the then narrow Bab al-Manab Strait from Djibouti and Eritrea onto Yemen (i.e. the Middle East), they went in several directions. Some migrated north, some went south while some moved eastwards. Middle East fossils dating from this period of time are very rare. However in 2008, Israeli anthropologists announced the major discovery of the Dan David Manot Fossils. These Later Modern Human fossils were found near the Western Galilee caves and were dated 60,000 years old. It was a significant find and the fossils are still being studied to this day by the Israeli
Antiquities Authority in 2014, led by Dr Omry Barzilai.
NEW UPDATED DATA
Aside from the 45,000 year old Niah caves fossils (Sarawak, Malaysia),
the notable absence of fossil evidence for modern human occupation in mainland Southeast Asia,
is due to the fact that fossils do not survive well in the warm, tropical region of eastern Asia.
NEW UPDATED DATA
However in 2012, scientists announced the results of a 2009 fossil find in northern Laos.
Professor Laura Lynn Shackelford, a paleoanthropologist at the University of
Illinois, revealed that the 2009 fossils discovered in a limestone cave,
located in Tam Pa Ling, at the top of the Pa Hang Mountain 3,840 feet (1,170 meters) above sea level,
were dated 55,000 to 63,000 years old.
They are the oldest later anatomically modern human fossils found in Southeast Asia.
A 2006 report in a molecular biology journal, which did MtDNA and Y-DNA ancestry tests on the Semang and Orang Asli,
places the date that the Semang and Orang Asli first arrived Malaysia as circa 50,000 years ago. More details at:
Molecular Biology and Evolution
Volume 23, Issue 12, 2480-2491, 2006. Dr Stephen Oppenheimer, a British geneticist whose
research work on DNA ancestry of the Semang, was mentioned by Dr Alice Roberts
in her BBC TV documentary, puts the date at which the ancestors of the Semang first
reached Malaysia as 55,000 years ago.
The famous Niah caves fossils in Sarawak, Malaysia, on the Indonesian Island of Borneo (excavated between 1954 and 1967 by Tom and Barbara Harrisson), are dated 45,000 years ago. They are the
2nd oldest modern human fossils known from Southeast Asia (after the 63,000 year old Tam Pa Ling fossils in Laos) and are believed to be from the ancestors of the Orang asli or Semang.
One group of people living on the Andaman
Islands, the Sentinelese,
remain virtually untouched by modern civilization, that in 2004 a famous photo
was beamed across the world showing the Sentinelese throwing stones and arrows
in a strange attempt to repel an Indian government helicopter (that probably
looked alien to them) surveying damage done by the 2004 Indian Ocean Tsunami.
The Indian government has imposed a permanent three-mile exclusion zone around
the islands to protect them. In 1997 MtDNA and Y-DNA analysis showed that most inhabitants
of the Sentinelese lived on the Andaman Islands for as long as 55,000 years ago (genetically
placing them as descendants of archaic Homo sapiens who interbred with arriving modern Homo sapiens sapiens) making them the oldest surviving human cultures in Asia, along side
the Semang and Orang Asli of Malaysia.
In Thailand we also find the Mani (maniq) indigenous peoples who first arrived Thailand
circa 44,000 years ago and in the Philippines we come across the earliest inhabitants of the Philippines, the Aeta or Ayta
who arrived roughly 40,000 years ago.
Both groups (in the rural areas) are mostly hunter-gatherers to this day (but some have adopted non-nomadic urban lifestyles),
and their origins mirror those of the Semang and Orang Asli.
Today the
Sentinelese (Nicobar and Andaman Islands); Orang Asli and Semang (Malaysia);
Maniq (Thailand); Aeta (the Philippines) and the Aboriginals (Australia) are the
oldest and earliest inhabitants in Asia. All other ethnic groups in Asia e.g. Han Chinese, Malay, Japanese, Mongolian
etc, arrived thousands of years later.
Photo of Aeta ethnic groups, the first indigenous people of the Philippines, whose ancestors arrived there 40,000 years ago. They look similar to the Australian Aborigines, because they both
carry the same Y-Chromosome DNA marker: the M130 mutation (as previously discussed in Section E).
1993 article in a British newspaper about the possible effects of the Sentinelese losing their isolation from the modern world.
About 28,000 years ago, modern humans in
East Asia (eastern
Why are the majority of ancient Paleo-Indian artefacts in the America's
dated from only 16,000 years ago?
As stated earlier on, about 28,000 years ago,
modern humans in East Asia (eastern Russia) crossed the Bering Straits (then known as Beringia)
onto the Americas, however
Clovis Culture artefacts only date from 14,500 years ago, while Folsom Culture artefacts only date from 13,000 years ago. How come??
Dr Stephen Oppenheimer in his book, The Real Eve: Modern Man's Journey Out of Africa,
provides an explanation. He points out that the main reason the majority of Clovis Culture artefacts in the
America's are dated as from 14,500 years ago was because the glaciers from the Last Glacial Maximum or LGM, destroyed
the early Clovis Culture sites. Had this not occurred, then the Clovis Culture artefacts
would have dated much earlier than 14,500 years ago. We would have some Clovis Culture sites dating from at least 20,000 years ago. LGM refers to
the period in the Earth's climate history when ice sheets were at their
most recent maximum extension, between 29,500 and 19,000 years ago.
Located near Pittsburgh, Pennsylvania, the Meadowcroft Rockshelter site is a rock ledge
overhang that was used as a campsite by prehistoric hunters and gatherers some 16,000 years ago.
Discovered in 1955, Meadowcroft Rockshelter is the oldest existing site of human habitation in
the Americas and its existence lends credence to the idea that humans arrived in the Americas
earlier than traditionally thought.
In 1975 in
In
North America, among the oldest Paleo-Indian remains discovered was the 13,800 year old so-called Eve of Naharon fossil discovered in
In
North America, we also come across the 10,800 year old so-called Peńon woman discovered in
SPECIAL LOOK AT BRITAIN 35,000 BC to 5000 BC
The diagram above shows the maximum reach of the glaciers of the last great Ice Age, 20,000 years ago.
During this time, much of Britain was covered in Ice, known as the
Devensian Interglacial. This glaciation had began 30,000 years ago.
It is related to the Last Glacial Maximum or LGM.
The Last Glacial Maximum refers to
the period in the Earth's climate history when ice sheets from the last major Ice Age were at their
most recent maximum extension, between 29,500 and 19,000 years ago.
The map above shows that in places like much of France, 20,000 years ago during the LGM,
the temperature was not too cold, so there were few or no glaciers, just Tundra (places
were tree growth is hindered by low temperatures
and short growing seasons.) The higher temperatures in southern Europe, allowed forests to cover much
of the area.
18,000 years ago, the huge ice covering most parts of Britain began to melt away,
known as the Windermere interstadial.
Did You Know That?
Glaciers or persistent ice sheets still exists in some European small towns/villages today: The Swiss Alps Glacial zone
(e.g. Engadin, Zermatt, Saas-Fee etc) are fine examples! Inhabitants are well protected against hypothermia all year round, with only avalanches to worry about.
One particular place on earth, you never imagined to find glaciers are at the southern parts of the towns of Puerto Williams and Puerto Toro in Chile.
They are the southernmost towns on earth and the closest major towns to Antartica. Both towns are not what you typically see on TV about Antartica: The summers are short and cool while the winters are long, wet, but moderate and not bone-chilling cold as in Antartica. Incidentally
Puerto Williams is port of entry and major hub for scientific activity linked to Antarctica.
There was one more glaciation in Europe: The Younger Dryas Interglacial also known as The Big Freeze.
It occurred around 12,000 years ago, but was a much smaller glaciation.
But because of the time
taken for the glaciers of the last great Ice Age to melt,
These 3 books: Britain Begins by Barry Cunliffe; A History of Ancient Britain by
Neil Oliver and Homo Britannicus: The Incredible Story of Human Life in Britain by Chris Stringer,
all suggests the first modern humans arrived Britain and Ireland for a final time, much later circa 13,000 years ago.
Meanwhile Stephen Oppenheimer in his extra-ordinary book Origins of the British: A Genetic Detective notes that
modern humans arrived Britain for a final time, circa 15,000 years ago. All four books are among the best for
reading about pre-historic Britain from 500,000 years ago. Meanwhile the famous Mesolithic site where modern
humans arriving Britain first settles is Blick Mead in Wiltshire, which dates from 10,000 years ago or 8,000 BC.
But unlike Gough's Cave in Somerset (also dating from 10,000 years ago), Blick Mead is officially, the oldest
site in Britain with continuous moden human habitation!!
How come ancient humans only existed continuously in Britain from 13,000 years ago? The reason is the Ice Age.
BREAKING NEWS
In March 2016, BBC News reported that scientists in Ireland, had discovered the earliest evidence of Cro-Magnons in Ireland. Fossils of
European bears that showed injure marks made by Cro-Magnons hunting them, were dated 12,000 years ago. This places Cro-Magnons in Ireland in the palaeolithic era. Previously the earliest evidence
of Cro-Magnons in Ireland was dated from the Mesolithic era, after 10,000 years ago.
Earlier on in Section F, I had mentioned that the Cro-Magnons are the earliest known form of anatomically modern humans found in Europe,
dating from about 35,000 to 45,000 years ago. The first Cro-Magnons thus arrived Europe about 45,000 years ago.
Another second migration of modern Homo sapiens into Europe, took place circa 35,000 years ago (palaeolithic) to 10,000 years ago (mesolithic)
and replaced most earlier versions of Cro-Magnon populations.
The First Modern Britons in Britain
Earlier on, in this ebook, it was noted that the very first ancient humans to appear in Britain, radio potassium-argon date
back to 600,000 years ago, such as the Homo heidelbergensis fossils found in Suffolk (East Anglia)
at Pakefield and in West Sussex e.g. Boxgrove man fossils.
Next the early Neanderthals (using Levallois tools) first appear about 300,000 years ago
i.e. Swanscombe Woman.
One good site were there is evidence of this at Baker's Hole in the Ebbsfleet Valley.
Other key palaeolithic pre-historic sites in Britain are at Happisburgh, Pakefield, Sussex,
Pontnewydd, Kent's Cavern, Paviland, and Gough's Cave.
But because of the many severe ice ages, the Levallois Neanderthals disappear, then
and reappear in Britain several times.
Fast forward to 60,000 years ago.
The later Neanderthals occupied Britain for one last time between 45,000 years ago and 60,000 years ago. Then around
40,000 years ago the Neanderthals have become extinct in Britain.
Then 32,000 years ago, the first modern humans begin to appear in Britain.
The earliest evidence of palaeolithic modern humans in Britain is a jawbone discovered in England
at Kent's Cavern in 1927, correctly dated in 2011 to 30,000 years ago. The so-called
Red Lady of Paviland fossil discovered by William Buckland in 1823 in the
Paviland caves of south Wales, is the oldest anatomically modern human fossil discovered
in Britain. It radio carbon-14 dates back to 32,000 years ago.
Because of the ancient age of these two fossils,
(during a period known as palaeolithic Aurignacian Culture ) it has been postulated that both
fossils while definitely being Cro-Magnon fossils, were probably among the very
first group of modern humans
arrived Britain just before 32,000 years ago in very small numbers
(i.e. less than 10,000 individuals). But when a brand new (but final) Ice Age
the Devensian Interglacial occurred and covered much of Britain 30,000 years ago, they all perished and
Britain was totally abandoned.
Just after 18,000 years ago, the huge ice covering most parts of Britain melted away, known as the Windermere interstadial, save for the still frozen English channel or Doggerland, allowing a fresh
new wave of modern humans from France to settle Britain once again permanently, from
13,000 BC or 12,000 years ago, eventually leading to what
historians call the Mesolithic Creswellian Culture (12,000 years ago).
This was followed by the Mesolithic Ahrensburg Culture (11,000 years ago) and finally the
Mesolithic Maglemosian Culture of 10,000 years ago. Cheddar Man (discussed later on) dating 10,000 years ago
was among Mesolithic arrivals into ancient Britain. Another famous 10,000 Mesolithic site where modern
humans arriving Britain first settled is Blick Mead in Wiltshire
All these cultures were all hunter-gatherers cultures until the
start of Neolithic ancient Britain when the first farmers arrived circa 5000 years ago from France.
You can read more about Mesolithic ancient Britain from this excellent text: Life in Britain after the Ice Age (Archaeology for All)
The beginning of the Bronze Age in Britain can be put around 2,000 BC or 4,000 years years ago. Although not certain, it is generally
thought that the new bronze tools and weapons identified with this age were brought over from continental Europe by migrants known as the Beaker People.
Finally the Ancient Human Occupation of Britain (AHOB) study is an ongoing project in the U.K.that charts out the occupation of Britain before and after 400,000 years ago.
Homo Britannicus: The Incredible Story of Human Life in Britain by Professor Chris Stringer is based on the AHOB project.
The above photo shows the famous Mesolithic Gough's Cave in a deep canyon on the southern edge of Somerset's Mendip Hills, Gough's Cave dates from at least 14,700 years ago.
It was the scene of the spectacular Mesolithic Cheddar Man fossils discovered in 1903, and dated
10,000 years ago. By the way Gough's Cave dates some 7,000 years before
Stonehenge was even built. Gough's Cave was one of the first cave sites inhabited by
Mesolithic modern humans (Cheddar Man fossils) when they returned to ancient Britain towards the end of the last Ice Age. Another famous Mesolithic site where modern
humans arriving Britain first settled is Blick Mead in Wiltshire, which dates from 10,000 years ago or 8,000 BC. But unlike Gough's Cave, Blick Mead is officially, the oldest
site in Britain with continuous moden human habitation!!
BREAKING NEWS:
In February 2018, British scientists at University College London and the Natural History Museum London were able to analyse
the genome (for genetic markers like SNPs, discussed in Section E) of the famous 10,000 year old Ceddar Man fossils discovered
at Gough's Cave in
Somerset (discussed in detail in Section I) and made an important discovery: SNPs for the genes that give dark skin colour in
modern humans i.e. the MC1R gene, were found in Cheddar Man's genome. Instead of finding only SNPs for SLC24A5 genes on chromosome 15 and no SNPs for MC1R genes on chromosome
16 on Cheddar Man's decoded genome, they found SNPs for MC1R genes instead on chromosome 16 and no SNPs for SLC24A5 genes on chromosome 15. This suggests the SLC24A5 gene that
gives light skin colour in modern humans may have only appeared in some migrants to Europe
after at least 10,000 years ago, and not before 10,000 years ago in migrants into Europe. Recall that modern humans arrived Europe roughly 45,000 years ago. This also means that
while evolution got to work enabling lighter skin colour to be manifested in modern humans migrating from Africa to Europe, not all the migrants had
lighter skin colour changes to
enable the skin absorb more sunlight to make vitamin D in cold climates. Some early modern humans arrived modern Europe with darker skins colours
(as supported by the Cheddar Man discoveries in February 2018).
But Natural Selection was the reason why all the remaining darker skin ancient human migrants in Europe had lighter skin colour eventually.
Today the MC1R gene remains inactive in modern day Europeans (i.e. European ancestry) on chromosome 16 due to a permanent mutation, meanwhile
active variants of the SLC24A5 genes are found on chromosome 15 in modern day Europeans (i.e. European ancestry). But an analogy of the MC1R gene presents itself when modern Europeans
visit hot tropical climates for holidays such as Brazil or North Africa and get a temporary skin tan. The skin tan is not due to the inactive MC1R gene being reactivated but simply the exposure to longer periods
of the sun in hotter tropical climates directly causing melanin genes in skin cells to produce large amounts of melanin.
A Look At All the Glacial Cycles of the last Ice Age in Britain (later part of the Quaternary Period) from 600,000 Years Ago to the Late Pleistocene Epoch
The Devensian Interglacial was not the first time extreme cold and
ice caused ancient Britain to be completely abandoned. Warmer periods of the ice ages are called
interstadials or temperate periods, and very cold severe glaciations are termed stadials or Interglacial periods.
An ice age in fact often refers to a group of several cold periods or glaciations that take place over a relatively short period of time. According to The Geological Society of London, The Theory of Milankovich Cycles, named after Dr Milutin Milankovich, is the universally accepted explanation as to why the earth witnessed several Glacial Cycles of stadials and interstadials. His theory states that Glacial Cycles of the last Ice Ages were caused by a combination of effects: alterations in the shape of the Earth's orbit around the Sun from nearly circular to much more elliptical; a change in the tilt of the Earth's rotational axis; and variations in the direction of the axis of rotation.
The most recent or last Ice Age on Earth is called the Quaternary Period.
Going back in time, around the 600,000 years ago, when the very first ancient humans
lived in Britain e.g Boxgrove man ( Homo heidelbergensis) fossils, the first glacial to occur was the Beestonian Interglacial.
Next a much warmer period (or the Cromerian Interstadial temperate period) then followed.
The Anglian Interglacial
(circa 400,000 years ago)
is one
example of a much harsher and extremely cold glaciations following the Cromerian Interstadial that caused Britain to be
completely abandoned by the Boxgrove man and other Homo heidelbergensis then in ancient Britain.
Soon a much warmer period (or the Hoxnian Interstadial temperate period) then followed,
allowing repopulation of Britain, this time by new arrivals, the fussy Levallois Neanderthals, e.g.
Swanscombe Woman, circa 300,000 years ago.
But no sooner had the Levallois Neanderthals settled down in ancient Britain to raise families and enjoy mammoth hunting raids for food, yet another severe glaciation circa 130,000 year ago occurred, known as
(the Wolstonian Interglacial) or Saalian glaciation, soon forcing total abandonment of ancient Britain yet again. Apparently, the
Hoxnian interglacial was not permanent. From beginning of the Wolstonian glaciation,
there were no Neanderthals or anyone else living in ancient Britain as historian Neil Oliver
notes in his book and enjoyable BBC TV series:
A History of Ancient Britain .
Around 100,000 years ago in ancient Britain a warmer period or the Ipswichian or
Eemian Interstadial temperate period occurred.
With the Ipswichian Interstadial in full swing, new waves of Later Neanderthals began
to settle Britain again circa 60,000 years ago, but these new arrivals were on borrowed time as they
became
permanently extinct in Britain by 40,000 years ago.
Modern humans then appear in Britain 32,000 years ago. But they too
had to abandon Britain, when the last glaciation, the
Devensian Interglacial, also called Oldest Dryas occurred circa 30,000 years ago.
With no more major glaciations occurring after the Devensian glaciation ran its course,
a warmer interstadial occurred known as the (Windermere interstadial), circa 18,000 years ago. Around 13,000 BC (or 15,000 BC as others sources calculate) repopulation of Britain occurs again. This time they are here for good. With the temperature of the Windermere interstadial getting warmer and warmer,
the English Channel,
then rock solid ice bridge between France and Britain i.e. Doggerland, melts away circa 10,000 years ago, and Britain permanently became an island. In 1990 a huge tunnel under the
English Channel from
France to Britain was built, connecting Britain directly to France once again, and in 1994 the Channel Tunnel or Euro Tunnel was born.
There was one more glaciation: The Younger Dryas Interglacial also known as The Big Freeze or Loch Lomond stadial. This occured in the
Late Pleistocene Epoch.
This one was rather petite compared to the others. It occurred around 12,000 years ago. But because it was a much smaller glaciation,
it was bearable by the ancient Britons now living in Britain, so no abandonment occurred.
Today in Britain we are in
The Holocene Epoch or post Windermere interstadial (12,000 years ago (Late Pleistocene Epoch) to the present day), this period covers the time ice retreated after the last glaciation and it is sometimes regarded as just another interglacial period.
Will there be a future Interglacials? or are stadial glaciations no longer possible? Global warming today, seems to make that no longer feasible.
Curiously, the Ancient Human Occupation of Britain (AHOB) study has shown that
ancestors of modern humans who came to Britain were forced to leave (or perished) eight times.
Meaning Britain was unoccupied about eight times from about 500,000 years ago.
The last time this happened was from 18,000 years ago to 30,000 BC, when Britain was unoccupied by
any human species.
This thus fits various research work which illustrates the fact that
Britain and Ireland have only been continuously occupied by modern humans from about 12,000 years ago to 15,000 years ago.
In early 2014, The British Natural History Museum in London (my 2nd favourite place to visit for my weekends in London, after the British Museum)
published a new book Britain: One Million Years of the Human Story
written by Dr Rob Dinnis and Dr Chris B. Stringer (Chris Stringer is Britain's foremost expert on human origins). ISBN-13: 978-0565093372. This book
traces the first habitation of Britain from Boxgrove man to the Cro-Magnons onto modern day Britons.
Iceland
The Inuits (Eskimos) and Aleuts and other indigenous populations reached and
settled in the Arctic regions near the north pole (indigenous populations of
northern Alaska, northern Canada, northern Greenland and northern Siberia) around AD
1000. A thousand years later evolution and natural selection has completely kicked in and has allowed these
indigenous populations to survive in these very cold places. Anyone whose ancestry is outside the
Arctic regions will simply struggle to survive here, as our bodies have not been able to adapt to extreme cold weather as the Inuits (Eskimos) and Aleuts have. For instance the indigenous populations are stocky in build (a cold weather adaptation created by evolution, as seen in the Neanderthals who had to survive the Ice Ages in Europe) and
under their skin are much bigger layers of healthy fat to insulate them against very cold weather. These guys can eat lots of fatty food rich in cholesterol and never get heart disease, thanks to evolution.
Meanwhile the
south pole (Antarctica) was uninhabited until explorers Roald Amundsen and Robert Falcon Scott reached it in 1911.
Antarctica today is covered permanently by thick layers of ice, making it extremely inhospitable
to humans. And, unlike the Arctic regions, it had no indigenous population of humans when
modern man arrived there in 1911. Today, we have just research bases at Antarctica.
The reason why Antarctica (twice the size of Australia) had no indigenous population of humans, is that unlike the Arctic regions, getting to Antarctica
involves a danger-fraught journey over cold open ocean (the Southern Ocean), and once you're there, it was just as hard to get back for ancient humans.
Antarctica is the coldest, driest and windiest place on earth. Meanwhile the Yakutia (Sakha Republic) is home to the coldest inhabited place on earth.
Yakuta is located in the
North eastern part of Russia (northern parts of Russia's Arctic regions). Just as in the case of the
Inuits (Eskimos) and Aleuts, and other indigenous populations of the Arctic regions, The Yakuts of Yakutia have benefited from
a thousand years of evolution and natural selection making them adapt to extreme cold weather.
After Ice: A Global Human History 20,000-5000 BC by Steven Mithen
provides a detailed account of human life on earth the
once the Ice Age had come and gone.
About
10,000 BC or 12,000 years ago or the start
of Neolithic Age or New Stone Age,
people living in the Fertile Crescent in the Middle East, where the climate was
much warmer but not too hot as in tropical Africa or cold as Europe, are the first to begin to
grow plants and crops for food and breed and domesticate animals. The first
crops cultivated by humans were barley, wheat (wild cereal grasses native to
As the diagram above shows, between 200,000 years ago and 10,000 BC, all humans worldwide were simple hunter-gatherers and nomads moving from place to place hunting and gathering 24 hours a day, at the most. Men in groups hunted food (wild animals) with spears and other stone weapons, while women and children gathered wild fruits and other plants. According to Professor Jared Diamond, in his worldwide best-seller Guns, Germs and Steel
a lucky chance discovery was made circa 10,000 BC by a group of people in Fertile Crescent, who discovered that if seeds
are planted in good soil, they will yield edible plants on the very spot they were planted, so there is no longer any need to
wander about collecting plants and have a nomadic lifestyle.
The Invention of Agriculture brought about profound changes in human way of life: small settlements
which started when people stopped being nomadic and began to live in groups to farm and harvest, grew into villages then towns and soon towns grew to become city-states
and developed into different civilisations and cultures with the political entity of a head of state or a priest-king (or ensi), pharaoh, ruler, overlord, leader, chief, king, monarch, queen, emperor, etc, who set about consolidating land and expanding their territories with borders, leading to empires such as
Mesopotamia (Sumer, Akkadia, Babylonia, and Assyria), Elam (Persia), ancient Egypt, and the Hittites.
However as city-states with not well defined borders began to grow, their spheres of influence overlapped, creating arguments between other city-states
leading to regional conflicts as armies battled each other for control. Since first civilization in human history was that of the Sumerians, the
evidence of war between quasi city-states came from crude
pictographs of armies at war discovered in the City-State of Kish, and dated to about 3,500 BC.
Within southern Mesopotamia, the archaeological record indicates that over the course of hundreds of years from about 8,000 BC,
the banks of the famous ancient Tigris and Euphrates rivers became ever more thickly studded with farming villages.
Some of these became religious centres, each home to a small temple of a local god which the
people of the surrounding villages worshipped. It was these centres which later evolved into the Sumerian city-states of later centuries.
A large Sumerian-state typically held between 30,000 and 40,000 inhabitants and notable city-states included Lagash, Kish, Uruk, Ur, Nipur and Umma.
All these city-states, typical of human nature, strove to subdue one another with endless wars and invasions, and some rose to a position of dominance over some or all of the other
cities of southern Mesopotamia, and beyond.
The diagram above shows the early major city-states ancient of the 1st empire in the world, the Sumer empire in southern Mesopotamia (in modern day southern Iraq).
In northern Mesopotamia we see the rising rival empire of the Akkadian empire, so called after the city-state of Akkad founded by Sargon I (in modern day
northern Iraq). They would become the 2nd earliest empire in the world after invading and conquering the Sumer empire.
The Akkadians themselves would later be subdued by another great Mesopotamia empire: the Akkadian-speaking empire of the Assyrians (northern Iraq).
A few centuries later, another great empire emerged: the Akkadian-speaking empire of the Babylonians (southern Iraq). Mesopotamia was not
the only location of the first great empires. Further east of Mesopotamia will witness the rise of the empire of the Hittites of
ancient Turkey, based around the city-state of Hattusa. Meanwhile another empire was already thriving south of Mesopotamia: the empire of the ancient Egyptians.
Also east of Mesopotamia in the map above is the empire of Elam (located in modern day southwest Iran). Elam was an ancient civilization founded just after the Akkadian empire.
The capital of Elam was a city-state called Susa, founded around 5,000 BC, and during its early history, fluctuated
between submission to Sumerian and Elamite rule. Elam would later on in time give rise to a famous empire: the Persian Empire.
The Persians would go on to conquer all of Babylonia and other nearby city-states and become one of the last major ancient dominant empire in the Middle East
before the arrival of Alexander the Great and the Romans later on.
Historians however say that the first war in recorded history in Mesopotamia took place in 2,700 BC between ancient Sumer (in modern day Iraq) and
ancient Elam (in modern day Iran) . Sumerian king Enmebaragesi (ruler of Kish) led his huge army against the Elamites. The root cause: concerns about borders and limited resources.
Detailed account of the famous war was later recorded in Cuneiform writing on a stone monument (stele) erected by King Eannatum, ruler of Lagash in Sumer, commemorating his own victory over the ruler of Umma, a local Sumer rival in 2525 BC.
There were of course other minor wars or skirmishes before 3,500 BC,
but Cuneiform writing and Hieroglyphics, had only been invented circa 3500 BC so was
still in its infancy before 3,500 BC .
However there was some sort of pre-Cuneiform activity indicating conflict
on a scale we can call a minor war or a skirmish before 3,500 BC.
Examples include numerous human remains clustered together
with evidence of violent deaths from early versions of composite hunting bows dating
10,000 BC and discovered in Mesopotamia. At the so-called Site 117, in Jabel Sahaba, ancient pre-Dynastic Egypt (so way before Hieroglyphics was invented),
we find evidence of a major conflict that took place there around 8,000 BC. Both Jericho and Uruk (world's oldest cities) provide evidence that both
were heavily
fortified before 7,000 BC to protect against earlier armed invasions.
However there are no definite accurate records
of any major battle worldwide occurring before 3,500 BC, even in the Bible's first book: The Old Testemant Book of Genesis. The first recorded war in the Bible (described in the Book of Genesis in Chapter 14) was the Battle of the Vale of Siddim, between Amraphel the King of Schinar; Chedorlaomer the King of Elam and their allies on one side and Bera,
the King of Sodom; Birsa the King of Gomorrah and their allies, it dates circa 1,800 BC. Schinar and Chedorlaomer combined forces won and they pillaged and plundered the cities of Sodom and Gomorrah (today's Bab edh-Dhra in Israel).
The first recorded war in Asia, naturally occurred in Asia's first major civilization, China. Records clearly show that
the Chinese Zhou Dynasty gained ascendancy through a major battle fought in 1,046 BC: The Battle of Muye, which overthrow the Shang dynasty. The Shang dynasty is the oldest period of Chinese history supported by archeological evidence.
The first recorded war in Europe is the Greek Trojan War (in Homer's Iliad ) circa 1,190 BC.
The Iliad narrates one series of events during a long but fascinating
war between the ancient Greeks and the Trojans (ancient people from land known as Troy).
During period the Trojan War took place, oral tradition prevailed in ancient Greece
because the alphabet was only introduced to the ancient Greeks by the Phoenicians circa 980 BC.
In fact most of Homer's first books were all based on oral tradition. However it should be noted that
the Mycenaeans were Bronze Age Greeks who took part in the Trojan War. Curiously the Mycenaeans
already had a written language, Linear B (an ancient form of early Greek) dating well before 1200 BC,
so before the Trojan War. So why on earth wasn't Linear B used to write stories about
Trojan War? The reason is simple: just prior to the Trojan War, the civilization of the Mycenaeans
had declined and ancient Greece was now in a period of time known to historians as the Dark Ages.
During this period,
there was no further architecture, sculptures, or paintings to speak of. Intellectual activity suddenly ceased in ancient Greece.
The technique and skills of writing (i.e. the Linear B script) was lost forever.
But the literature and epic stories about the Trojan War lived on in strong oral tradition.
When the ancient Greeks were once again re-introduced to writing by the Phoenicians circa 980 BC,
one of the first prolific authors was Homer and naturally the first books he chose to write about were on the huge
backlog of epic stories in oral tradition about the Trojan War!
The famous Battle of Kadesh circa 1,274 BC between two very hostile neighbours with large empires, the ancient
Egyptians ruled by Rameses II and the Hittites
under Muwatalli II is the earliest battle in recorded history for which extensive details of tactics are known. This some
1000 years before famous Chinese writer and military tactician Sun Tzu wrote the famous the Art of War tutorial!
The Battle of Kadesh was a major conflict that occurred over three thousand years ago, tactically it was
a costly Pyrrhic victory for ancient Egypt because of the significant losses to the
ancient Egyptians. Some historians claim the Battle of Kadesh was a draw. Others claim it was a
costly Pyrrhic victory for Hittites. The details of the battle which allowed the rest of the world to know about it
came from the discovery of hundreds of Hieroglyphics carved on the walls of the
many temples and monuments of Rameses II, as seen in the photo above.
The way agriculture transformed the lives of a small group of people on deserted barren land, miles away from civilisation and facing starvation, is best illustrated in modern times by looking at how the U.S. developed from a small group
of Pilgrims in Plymouth back in 1620. After being unable to farm on the new land for several months and facing starvation with supplies running out,
and no nearby town to turn to for help, the Pilgrims were eventually taught how to grow corn (maize) by Native American Indians such as Squanto (Tisquantum) in 1621, (corn being the only staple grain at the time). Soon the farming settlement developed into a town and then more towns followed as the population expanded.
The U.S. holiday of Thanksgiving is based on how agriculture saved the settlement of Plymouth from extinction.
As noted in the book A History of World Agriculture : From the Neolithic Age to Current Crisis by Marcel Mazoyer and Laurence Roudart,
not all parts of the world adopted agriculture at the same period of time. The authors of the book explains why agriculture
spread through sub-Saharan Africa much later than it did through other parts of the world,
despite being the cradle of mankind. Much of sub-Saharan Africa (except east Africa) remained
hunter-gatherers and nomadic or semi-nomadic lifestyles until about 200 BC. It was this lateness which explains much of sub-Saharan Africa developed much more slowly compared to Europe, the Middle East and Asia, and the effects of this are still being felt today.
The most important domestication
that helped earlier humans travel long distances as well as mobility in battles, was the domestication of
the horse from wild horses, in the Middle
East circa 4,000 BC. The ancient Egyptians, the Assyrians, the Persians, the Hittites and the Babylonians were among the first civilizations to use domesticated horses
in battle, enabling them to build large empires. But it was the Romans that took using domesticated horses in battle to the next level!
The Bronze Age began circa 4,000 BC.
Our early human ancestors from Homo habilis had
used stone tools continuously from 2.6 million years ago, until they discovered metals like
copper (7,000 BC) and tin leading to the Bronze Age circa 4,000 BC. There is a hot debate about where exactly the Bronze Age
began. The leading contenders are 1) Anatolia (ancient Turkey); 2) Sumer (ancient Iraq)
and 3) ancient Egypt.
Bronze Age technology then spread westwards towards rest of Europe and eastwards towards rest of
Asia, meaning Eurasia
was the first region in the world to experience Bronze Age technology. Bronze Age technology
arrived very late in the Americas.
Cuneiform writing and hieroglyphics,
clearly the first successful attempts by humans to read and write, are invented 3,500 BC. Before then everyone in the ancient world was illiterate! But literacy was not achieved overnight, because even in medieval times,
very few people could read and write. Literacy gained ground around the time of the Renaissance and the invention of book printing.
Stone huts and homes
(replacing wood and mud huts etc) used for the first time in places like ancient
A Special Look at the Indo-Europeans Legacy
During the early stages of the Bronze Age between 4,000 BC and 2,000 BC or 6,000 years ago sees the steady continuous arrival of the
Indo-Europeans into Europe and Western Asia (Iran, Pakistan, India as well as former Kurdistan).
The Indo-Europeans change the culture, lifestyle and population structure of Europe and Western Asia forever.
One lasting legacy are the languages spoken from Ireland to India (The Nostratic Hypothesis). Virtually all European languages
and Western Asia modern languages (except Hungarian, Basque, Finnish, Turkish, Arabic and Hebrew) are
Indo-European in origin (this fact was discovered in the 1700s by William Jones, a British scholar, who noticed language structure similarities between Sanskrit, Greek and Latin). Hittite, spoken in
ancient Asia Minor (Turkey) and Tocharian, spoken in ancient western China are now both extinct languages
but both were Indo-European languages.
Finnish and Hungarian belong to the Finno-Ugric language family, while Basque is of unknown origin. Arabic and Hebrew are Semitic languages. Turkish belongs to the
Turkic languages such as Azerbaijani and Turkmen. Etruscan is an example of an extinct non-Indo European language once spoken in Europe (Italy). Among the proposed early Indo-Europeans are the mysterious Kurgan.
Today all Indo-European languages are written
in 5 major alphabets viz: the Roman, Modern Greek and Cyrillic alphabets (all of Europe), Arabic alphabet
(Iran and Pakistan as well as the Kurdish language of the Kurds) and the Brahmi alphabet (India, Bangladesh, and Pakistan).
The reasons why Basque is not an Indo-European language draws some very interesting facts. Because of the
hidden and remote mountainous location of
early Basque territory, the route taken by Indo-European neolithic migrants as they "invaded" Europe, did not pass through Basque territory, allowing
the Basque people to retain their original language, culture and lifestyle after the Indo-European "invasion". When the Romans and later the Germanic ethnic groups and the Vikings all invaded the different parts of Europe,
Basque territory was ignored once again thus allowing
Basque people to continue to retain their original language, original culture and original lifestyle.
The neolithic Indo-European "invasion" did also bring another lasting legacy:
introduction of farming / agriculture to mesolithic ancient Europe. Today, the Basque people have the oldest ancestry in Europe due to none assimilation with Indo-Europeans and direct links to the Cro-Magnons. Also the
Basque people have the oldest surviving indigenous (or native) language today in Europe
having avoided invasion by the Romans, the Germanic / Barbarian ethnic groups, the Vikings and the Moors
(who only invaded Spain). Basque is thus the last of the ancient pre Indo-European languages of Europe
surviving today. Basque language is dated over 7,000 years old so
the language predates the Indo-European invasion which dates back 6,000 years ago.
GENETIC EVIDENCE
NEW UPDATED DATA
Back in Section E of this eBook we learn that although the enjoyable book, The Seven Daughters of Eve shows how the ancestry of 99% of
all Europeans can now be traced back to just seven women. In May 2015, scientists at the University of Leicester in Britain led by Professor Mark Jobling
and Dr Chiara Batini have uncovered a more stunning fact: Most European men descended from just three male ancestors (from the Bronze Age period, 6,000 years ago). Unlike Professor Bryan Sykes who used MtDNA for his discoveries, the University of Leicester scientists used the other type of marker known as Y-Chromosome DNA. The most common Y-Chromosome DNA haplogroup in Europe is the R haplogroup representing over 75% of the native population of Europe. The R haplogroup itself is composed of smaller sub-haplogroups
such as: R1b (Western Europe) and R1a (Central and Eastern Europe). The next most common haplogroup in Europe is the
I haplogroup, it is one of the oldest Y-Chromosome DNA Haplogroups in Europe and associated with the ancient European Gravettian Culture).
The I haplogroup subclades such as I2 and I1 covers 10% of European population, but it is particularly found in larger frequencies in Scandinavia (Iceland, Norway, Denmark and Sweden). What the University of Leicester scientists discovered was that, three distinct mutations occurred in 63% of the 700 male volunteers they tested. The mutations were found in the R1a, R1b and I1 haplogroups. Clearly back in Bronze Age Europe, 6,000 years ago, three ancient men (Proto-Indo-Europeans, and each one carrying the R1a, R1b and I1 markers) and postulated to be the Yamnaya (or Kurgan), are the ancestors of over half of European males today and mutations in these three men (i.e. the genotypes) all had three phenotype similarities: they all had light skin, a range of eye and
hair colours and nearly all can happily drink milk, in other words modern Europeans do not look much like those of 8000 years ago. Another lasting legacy was that these three men brought along a Proto-Indo-European language which has evolved into 99% of all the languages spoken today all over Europe.
Molecular genetic tests have since also confirmed the rather ancient
ancestry of the Basques. Renowned geneticist Professor Emeritus Luigi Luca Cavalli-Sforza (Stanford University) in his fascinating book (The History and
Geography of Human Genes, 1994) notes
that the Basque people have the highest frequency of Rh-Negative (Blood Group) genes anywhere in Europe.
This was explained by the fact that invading
Indo-Europeans were mostly Rh-Positive (as is most of the world in Africa and Asia) and most of ancient Europe (before the invasion) were mostly Rh-Negative.
The reasons why most of ancient Europe (before the Indo-European invasion) were mostly Rh-Negative is not properly understood, however genetic studies do show that Rh-Negative blood group in ancient Europe goes back at least 45,000 years, during the time of the Cro-Magnons.
However much Europe today have diluted or
mixed frequency of Rh-Negative and Rh-positive genes, due to dilution of Rh-Negative ancient Europe
with Rh-Positive Indo-Europeans. The ratio in Europe today is 25% Rh-Negative and 75% Rh-Positive,
the ratio in Basque today is 95%
Rh-Negative. Meanwhile in Asia and Africa today, Rh-Positive is over 95% and Rh-Negative less than 5%.
Since Indo Europeans did not cross paths with the Basques in southern Spain,
the Basques have retained the high frequency of Rh-Negative genes seen today. The Basques retain the
high frequency of Rh-Negative genes primarily due to the high frequency of the null allele within the Basque population (the null allele is a recessively expressed trait).
The Scandinavians have the second highest
frequency of Rh-Negative genes. It is easy to see why: Much of ancient Scandinavian during the Bronze Age
was very very cold (still recovering from the effects of the last Ice Age) and when the Rh-Positive Indo-Europeans arrived, very few ventured up north into Scandinavia, preferring the less colder parts elsewhere in Europe.
The Invention of Zero and Early Numeral Systems
During the Bronze Age, further
major ancient civilizations joining the civilizations of the Sumerians, ancient Chinese and ancient Egyptians are the Minoans
in Crete, near modern day Greece; Phoenicians along the eastern coast of Mediterranean at modern day Syria and Lebanon; Babylonians near
modern day
NEW UPDATED DATA
Strange, but the concept of Zero was invented over 2,000 years ago, before the invention of the numerals, 1, 2, 3, 4, 5, 6, 7, 8, 9, and . by ancient Indian mathematicians circa 5th century AD during the Gupta Dynasty,
(it was called the Indian Decimal Numeral System). Ancient Gupta Dynasty Indian mathematicians most notably Brahmagupta and Aryabhatta used . or a small dot underneath any of the first nine numerals to indicate the place of a zero! So a dot under the number 9 represented 90!
Before Indian (Hindu) Numerals were invented, there were dozens of different ways of writing down numbers elsewhere: the ancient Egyptians used the Hieratic Numeral System for
numerals, using over 32 symbols; the Mayan Numeral System used in ancient Mexico
was even more cumbersome to use as it was not decimal and also used numerous symbols. Ancient Chinese mathematics did the same thing as well using a selection of Chinese ideograms for numbers.
The Babylonian Numeral System was based on the number 60 (i.e. sexagesimal) and they used over 20 symbols to represent numbers. Moving over to Europe, the ancient Greeks used the Ionian Numeral System which used letters
in the ancient Greek alphabet to represent numbers. Meanwhile the Romans in the Roman Empire, also used letters (derived from the Latin alphabet) to represent numbers,
such as XXIV to represent 24, (i.e. Roman Numeral System). But these two major European number systems were
too cumbersome for advanced mathematics too, nevertheless somehow the ancient Greeks DID manage to do complex maths calculations with the Ionian Numeral System
before the western World adopted Arabic numerals. When the ancient Indian mathematicians invented the numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, and . for zero,
why was it based on 10?? well in those days, ancient people counted with their fingers, 10 fingers!
For over 350 years, no one knew of the existence of Indian (Hindu) Numerals outside India. It was ancient Persian traders in India who first came across
the Indian numeral system in the 8th century AD, they took it back to Persia, where Gondi Shapur University (also spelled Jundi Shapur or Gundishapur)
scholars adopted it for use all over the Samanid and Saffarid empires of Persia.
In the 10th century AD, Arabic mathematicians living in Persia, added several important modifications to the Indian (Hindu) Numerals such as the shape of each number
(still used today) AND adding the all important Chinese symbol for Zero (i.e 0) and not a simple dot or . used in the original Indian (Hindu) Numeral system, hence 1, 2, 3, 4, 5, 6, 7, 8, 9, 0
and these modifications soon
became the de facto way of writing numbers all over Middle East: known today by the name
Arabic Numerals. In the late 12th century AD, at the famous Toledo Translation School in Spain, Jewish and Spanish scholars translating numerous
Arabic versions of important ancient Greek science, philosophy and mathematics texts, came across several texts describing mysterious
Arabic Numerals being used throughout the muslim world, most notably in Alexandria, Baghdad, Cairo and Damascus. The scholars quickly saw that this
method of writing down numbers was way
much better that the current Roman numerals used all over Europe, especially in algebra and geometric calculations. Through the combined efforts of
several top European mathematicians in the 13th century, such as famous Leonardo Fibonacci (who published the maths book Leber Abaci in 1202, also called Liber Abaci), Europe abandoned
Roman numerals for Arabic numerals. From about the early 14th century AD, China and most other nations all soon adopted Arabic numerals as well.
Then of course.... there is the small matter of why 60 seconds = 1 minute and not 100 seconds = 1 minute. Babylonian astronomers were the
first to make important calculations about time,
and because they used a number system based on 60 (sexagesimal), they divided time based on the number 60, so 60 seconds = 1 minute and 60 minutes = 1 hour
(N.B. the words minute, second and hour are Greek name
inventions, and the Babylonians used native names for minute, second and hour).
This sexagesimal system was actually copied from the
Sumerians, who had developed it independently around 1,800 BC. The "60" came from the astonishing fact that 60 is the smallest number divisible by the first six counting numbers as well as by 10, 12, 15, 20 and 30. The Babylonian method of calculating time was thus so simplistic yet ground-breaking
that all the major
civilisations after the Babylonians soon adopted it readily: the Greeks, Romans, Chinese, Arabs, Indians, Persians etc. So by the time the Arabic Numeral System was adopted universally
in these important ancient civilisations, it was just damn too late to "decimalise"
the 4,000-year-old Babylonian way of calculating time!!
The 24 hours = 1 day was invented elsewhere: it was based on ancient Egyptian astronomy way of calculating precise time period of a full day using sundial (day time) and clepsydra (night time), much better then the Babylonians way of doing this!! Both the
sundial and clepsydra were the most accurate timekeeping device of the ancient world, before the clock was invented, the reason why 24 hours = 1 day is still used today, and not 100 or 60 hours = 1 day!!
POSTSCRIPT
Although it is no longer used for general computation, the sexagesimal system based on the number 60 is not only used to measure time, it is also still used to measure angles and geographic coordinates. In fact, both the circular face of a clock and the sphere of a globe owe their divisions to famous 4,000-year-old numeric system of the Babylonians.
The Greek astronomer Eratosthenes used a sexagesimal system to divide a circle into 60 parts in order to devise an early geographic system of latitude, with the horizontal lines running through well-known places on the earth at the time. A century later, Hipparchus normalized the lines of latitude, making them parallel and obedient to the earth's geometry. He also devised a system of longitude lines that encompassed 360 degrees and that ran north to south, from pole to pole. In his treatise Almagest (circa AD 150), Claudius Ptolemy greatly
expanded on Hipparchus' work by subdividing each of the 360 degrees of latitude and longitude into smaller segments. Each degree was divided into 60 parts, each of which was again subdivided into 60 smaller parts. The first division, partes minutae primae, or first minute, became known simply as the "minute." The second segmentation, partes minutae secundae, or "second minute," became known as the second.
Minutes and Seconds, however, were not used for everyday timekeeping until many centuries after the Almagest!!
The Invention of The Alphabet
NEW UPDATED DATA
The Phoenician script was an big improvement over the earlier non-alphabetic writing systems already in use
for thousands of years in the ancient Bronze Age civilisations in ancient Egypt; ancient India (Indus Valley); ancient China, ancient Iran (the Elamites); ancient Iraq
(Sumer, Babylonia and Assyria); ancient Crete (the Minoans); and ancient Turkey (the Hittites).
Only China still uses the ancient Bronze Age non-alphabetic system today, because the rest of the ancient Bronze civilisations above, all adopted the alphabet invented by the Phoenicians. Japan from the 5th century AD
uses a combination of three non-alphabetic systems: Kanji (introduced by Chinese Buddhist scholars) alongside Katakana and Hiragana. Meanwhile the Korean alphabet invented in the 14th century uses modified
Chinese characters, but it is alphabetic because each symbol has a sound value. The symbols in the Chinese script do not represent sound values, when native Chinese reads
the Chinese script, the sounds made are invented by the reader, this makes it possible for speakers of the numerous different Chinese languages
(like Mandarin, Wu and Cantonese) to use a single Chinese script!
Of the three major ancient Semitic inscriptions, as described earlier on, viz: the Serabit el-Kadem, the Ras Shamra and the Wadi el-Hol inscriptions,
Professor Orly Goldwasser of the Hebrew University of Jerusalem, writing in the respected journal, Biblical Archaeological Review
(Spring 2010 issue),
theorizes that it was the Serabit el-Kadem inscriptions that was modified by the Phoenicians for their own use in the Phoenician script.
The article by Professor Goldwasser also provides a fascinating narrative of just how the Semites (Canaanites),
working in turquoise mines for the Egyptians at Serabit el-Kadem in the Sinai, had out of curiosity, began looking
for a way to translate Egyptian hieroglyphics into their own Canaanite (Amorite) language, and unbeknown to them
invented an alphabetic writing system whose basic concepts would still be used today.
The alphabet is in no doubt, the
most important human invention after the all-important invention of agriculture circa 10,000 BC, alongside the invention of the wheel and the invention of
bronze (metal) tools) to replace stone tools.
Around 980 BC the Greeks are introduced to the alphabet by the Phoenicians (becoming the 5th nation
to adopt an
alphabetic writing system). The ancient Greeks are thus the first Western
Europeans to begin to write books such as the author Homer. Later on the Greeks pass on the alphabet
to the Romans (via the Etruscans) in Italy and the rest is history. You can learn more about the
earliest writing systems in the world in great detail, as well as the first books and libraries in the world,
in my new popular reference book: Library World Records 3rd edition by Godfrey Oswald,
published in September 2017 in the U.S. by McFarland & Co publishers.
The all-important Iron
Age finally began in Western Asia, (the Hittites in ancient Turkey were the first to discover the technology), and then spreads to
More inventions and
discoveries will be made in the 21st century and beyond such as: a safe
return trip to the planet Mars by humans; quantum computing; a universal cure for cancer; free energy perpetual motion machines that do not violate the rather strict first or second laws of thermodynamics; and finally a practical commercial way to utilise nuclear
fusion to generate energy (instead of the current nuclear fission reactors which produce too much toxic waste). The only current benefit of nuclear fusion humanity has found is
the manufacture of deadly powerful Hydrogen Bombs.
Humans have indeed come a very long way, from the very day we decided to leave the
trees and came down to live permanently on the ground 3 million years ago to evolve into the most dominant
mammal that we are today.
In the ensuing years since 1987, massive amounts of scientific research worldwide in the molecular biology labs in the U.S., Canada,
Mexico, Europe, Nigeria, South Africa, India, China,
Japan and Australia etc have all laid to rest any doubts about our African genetic origins.
While all non-African females today are descendants of L3 line from Africa, our earliest common father was one with a Y-chromosome DNA marker, M-168.
We are all Africans in origin 200,000 years ago. We all share a common genetic ancestry that far outweighs physical or cultural differences – today we may be of different colours,
different shapes; practise hundreds of different cultures and customs and speak thousands of very different languages, but all human DNA today is 99.9 percent identical.
I hope you enjoyed this eBOOK.
Two categories of sources are listed below: Main sources and Chronological Sources.
The Main Sources provided the main backbone for my research project from 2003 back in Geneva, and
when I returned to London, after finishing my overseas contract working for the UN in Geneva and Paris in 2004.
I started off this ebook with these sources alone, before using the other sources listed as
"Chronological Sources", to build up the contents of the ebook. Unlike the "Chronological Sources"
which will continue to grow as I quote brand new sources for the ebook, the "Main Sources" remain static.
Chronological Sources are simply a list of every single text book source used for the ebook in chronological order.
This list will continue to grow as I stumble upon new textbooks and other non-fiction work. Not included are
sources from journals, newspapers and magazines. However every single source from journals,
newspapers and magazines, are meticulously listed within this ebook, each time the source is quoted. In the case of journals, either the bibliographic detail of the
journal is provided, or a link to the journal's website is provided or both.
Awadalla
Philip, Adam Eyre-Walker, and John Maynard Smith (1999), “Linkage
Disequilibrium and Recombination in Hominid Mitochondrial DNA,” Science,
286:2524-2525, December 24.
The very 1st source I checked out, back in 2003, after reading the Newsweek magazine article.
Green et al. (2010), A Draft Sequence of the Neanderthal Genome. Science, 328:710.
Gibbons, Ann (1998), “Calibrating the Mitochondrial Clock,”
Science, 279:28-29, January 2.
Kahn P. and Gibbons A. (1997), DNA from an Extinct Human. Science, 277:176-8.
Krings M., Stone A., Schmitz R.W., Krainitzki H., Stoneking M., and Paabo S. (1997): Neandertal DNA sequences and the origin of modern humans. Cell, 90:19-30.
Krings M., Capelli C., Tschentscher F., Geisert H., Meyer S., von Haeseler A. et al. (2000), A View of Neandertal Genetic Diversity. Nature Genetics, 26:144-6.
Lemonick,
Michael D. (1987), “Everyone’s Genealogical Mother,” Time, p. 66, January 26.
Parsons, Thomas J., et al. (1997), “A High Observed
Substitution Rate in the Human Mitochondrial DNA Control Region,” Nature
Genetics, 15:363.
Other Main Sources: Mostly Periodicals on Palaeoanthropology
Abbate E., Albianelli A., Azzaroli A., Benvenuti M., Tesfamariam B., Bruni P. et al. (1998): A one-million-year-old Homo cranium from the Danakil (Afar) depression of Eritrea. Nature, 393:458.
Aiello L. and Collard M. (2001): Our newest oldest ancestor? Nature, 410:526-7.
Alemseged Z., Spoor F., Kimbel W.H., Bobe R., Geraards D., Reed D. et al. (2006): A juvenile early hominin skeleton from Dikika, Ethiopia. Nature, 443:296-301.
Asfaw B., White T.D., Lovejoy C.O., Suwa G., and Simpson S. (1999): Australopithecus garhi: a new species of early hominid from Ethiopia. Science, 284:629-35.
Asfaw B., Gilbert W.H., Beyene Y., Hart W.K., Renne P., WoldeGabriel G. et al. (2002): Remains of Homo erectus from Bouri, Middle Awash, Ethiopia. Nature, 416:317-20.
Balter M. (2010): Candidate human ancestor from South Africa sparks praise and debate. Science, 328:154.
Balter M. and Gibbons A. (2002): Were 'Little People' the first to venture out of Africa? Science, 297:26-7.
Balter M. and Gibbons A. (2000): A glimpse of humans first journey out of Africa. Science, 288:948-50.
Begun D.R. (2004): The earliest hominins - is less more? Science, 303:1478-80.
Berger L.R., de Ruiter D.J., Churchill S.E. et al. (2010): Australopithecus sediba: a new species of Homo-like australopith from South Africa. Science, 238:195.
Bermudez de Castro J.M., Arsuaga J., Carbonell E., Rosas A., Martinez I., and Mosquera M. (1997): A hominid from the lower Pleistocene of Atapuerca, Spain: possible ancestor to Neandertals and modern humans. Science, 276:1392-5.
Blumenschine R.J., Peters C.R., Masao F.T., Clarke R.J., Deino A., Hay R.L. et al. (2003): Late Pliocene Homo and hominid land use from western Olduvai Gorge, Tanzania. Science, 299:1217-21.
Brown P., Sutikna T., Morwood M., Soejono R.P., Jatmiko, Saptomo E.W. et al. (2004): A new small-bodied hominin from the late Pleistocene of Flores, Indonesia. Nature, 431:1055-61.
Brunet M., Guy F., Pilbeam D., Mackay H.T., Likius A., Djimboumalbaye A. et al. (2002): A new hominid from the upper Miocene of Chad, central Africa. Nature, 418:145-51.
Brunet M., Beauvilain A., Coppens Y., Heintz E., Moutaye A.H.E., and Pilbeam D. (1995): The first australopithecine 2,500 kilometres west of the rift valley (Chad). Nature, 378:273-5.
Burenhult G. (1993): The first humans: human origins and history to 10,000 BC. New York: HarperCollins.
Clarke R.J. and Tobias P.V. (1995): Sterkfontein member 2 foot bones of the oldest South African hominid. Science, 269:521-4.
Dean C., Leakey M.G., Reid D., Schrenk F., Schwartz G.T., Stringer C.B. et al. (2001): Growth processes in teeth distinguish modern humans from Homo erectus and earlier hominins. Nature, 414:628-31.
Delson E. (1997): One skull does not a species make. Nature, 389:445-6.
Dobson J.E. (1998): The iodine factor in health and evolution. The Geographical Review, 88:1-28.
Duarte C., Mauricio J., Pettitt P.B., Souto P., Trinkaus E., van der Plicht H. et al. (1999): The early upper Paleolithic human skeleton from the Abrigo do Lagar Velho (Portugal) and modern human emergence in Iberia. Proceedings of the National Academy of Sciences, USA, 96:7604-9.
Gabunia L., de Lumley M.-A., Vekua A., Lordkipanidze D., and de Lumley H. (2002):
Découvert d'un nouvel hominidé ŕ Dmanissi (Transcaucasie, Georgie). C.R.Palevol 1, 2002:243-53. English Translation via Google Translator.
Gabunia L., Vekua A., Swisher C.C., III, Ferring R., Justus A., Nioradze M. et al. (2000): Earliest Pleistocene hominid cranial remains from Dmanisi, Republic of Georgia: taxonomy, geological setting, and age. Science, 288:1019-25.
Gibbons, A. (2009): A new kind of ancestor: Ardipithecus unveiled. Nature, 326:36-40.
Haile-Selassie Y. (2001): Late Miocene hominids from the Middle Awash, Ethiopia. Nature, 412:178-81.
Haile-Selassie Y., Suwa G., and White T.D. (2004): Late Miocene teeth from Middle Awash, Ethiopia, and early hominid dental evolution. Science, 303:1503-5. (Ardipithecus kadabba)
Huang W., Ciochon R., Gu Y., Larick R., Fang Q., Schwarcz H.P. et al. (1995): Early Homo and associated artefacts from Asia. Nature, 378:275-40.
Hublin J., Spoor F., Braun M., Zonneveld F., and Condemi S. (1996): A late neanderthal associated with upper palaeolithic artefacts. Nature, 381:224-6.
Keyser A.W. (2000): The Drimolen skull: the most complete australopithecine cranium and mandible to date. South African Journal of Science, 96:189-93.
Kimbel W.H., Walter R.C., Johanson D.C., Reed K.E., Aronson J.L., Assefa Z. et al. (1996): Late pliocene Homo and oldowan tools from the Hadar formation (kada hadar member), Ethiopia. Journal of Human Evolution, 31:549-61.
Kunzig R. (1997): The face of an ancestral child. Discover, 18, 88-101.
Lahr M.M. and Foley R. (2004): Human evolution writ small. Nature, 431:1043-4.
Leakey M.G., Spoor F., Brown F., Gathogo P.N., Kiarie C., Leakey L.N. et al. (2001): New hominin genus from eastern Africa shows diverse middle Pliocene lineages. Nature, 410:433-40. (announcement of the discovery of Kenyanthropus platyops)
Lieberman D.E. (2001): Another face in our family tree. Nature, 410:419-20.
Lontcho F. (2000): Georgia Homo erectus crania. Archaeology 53(1)
McDougall I., Brown F.H., and Fleagle J.G. (2005): Stratigraphic placement and age of modern humans from Kibish, Ethiopia. Nature, 433:733-6.
McHenry H.M., Berger L.R. (1998): Body proportions in Australopithecus afarensis and A. africanus and the origin of the genus Homo. Journal of Human Evolution, 35:1-22.
Moggi-Cecchi J. (2001): Questions of growth. Nature, 414:595-6.
Morwood M., Soejono R.P., Roberts R.G., Sutikna T., Turney C.S.M., Westaway K.E. et al. (2004): Archaeology and age of a new hominin from Flores in eastern Indonesia. Nature, 431:1087-91.
Partridge T.C., Granger D.E., Caffee M.W., and Clarke R.J. (2003): Lower Pliocene hominid remains from Sterkfontein. Science, 300:607-12.
Potts R., Behrensmeyer A.K., Deino A., Ditchfield P., and Clark J. (2004): Small mid-Pleistocene hominin associated with East African Acheulean technology. Science, 305:75-8. (discovery of OL 45500)
Reich, Green, Kircher et al. 2010: Genetic history of an archaic hominin group from Denisova Cave in Siberia. Nature 468:1053.
Schwartz J.H. (2004): Getting to know Homo erectus. Science, 305:53-4.
Semaw S., Renne P., Harris J.W.K., Feibel C.S., Bernor R.L., Fesseka N. et al. (1997): 2.5-million-year-old stone tools from Gona, Ethiopia. Nature, 385:333-6.
Senut B., Pickford M., Gommery D., Mein P., Cheboi C., and Coppens Y. (2001): First hominid from the Miocene (Lukeino Formation, Kenya). Comptes rendus des seances de l'academie des sciences, 332:137-44. (discovery of Orrorin tugenensis)
Serre D., Langaney A., Chech M., Teschler-Nicola M., Paunovic M., Mennecier P. et al. (2004): No evidence of Neandertal mtDNA contribution to early modern humans. PLoS Biology, 2:313-7.
Stringer C.B. (2003): Out of Ethiopia. Nature, 423:692-4.
Susman R.L. (1994): Fossil evidence for early hominid tool use. Science, 265:1570-3.
Suwa G., Asfaw B., Beyene Y., White T.D., Katoh S., Nagaoka S. et al. (1997): The first skull of Australopithecus boisei. Nature, 389:489-92.
Swisher C.C. III, Rink W.J., Anton S.C., Schwarcz H.P., Curtis G., Supryo A., and Widiasmoro (1996): Latest Homo erectus of Java: potential
contemporaneity with Homo sapiens in southeast Asia. Science 274:1870-1874.
Tattersall I. (1993): The human odyssey: four million years of human evolution. New York: Prentice Hall.
Tattersall I. and Schwartz J.H. (1996): Significance of some previously unrecognized apomorphies in the nasal region of Homo neanderthalensis.
Proc.Natl.Acad.Sci.USA 93:10852-10854
Tobias P.V. (2003): Encore Olduvai. Science, 299:1193-4.
Vekua A., Lordkipanidze D., Rightmire G.P., Agusti J., Ferring R., Maisuradze G. et al. (2002): A new skull of early Homo from Dmanisi, Georgia. Science, 297:85-9. (D2700)
White T.D., Asfaw B., DeGusta D., Gilbert H., Richards G.D., Suwa G. et al. (2003): Pleistocene Homo sapiens from Middle Awash, Ethiopia.
Nature, 423:742-7.
White T.D., Asfaw B, Beyene Y., Haile-Selassie Y., Lovejoy C.O., Suwa G., WoldeGabriel G. (2009): Australopithecus ramidus and the
paleobiology of early hominids. Science, 326:75-86.
Wood B. (2002): Hominid revelations from Chad. Nature, 418:133-5.
Wood B.A. and Collard M. (1999): The human genus. Science, 284:65-71.
Wood B.A. and Collard M. (1999): The changing face of genus Homo. Evolutionary Anthropology, 8:195-207.
Wood, B. (2006): Palaeoanthropology: a precious little bundle. Nature, 443:296-301.
Every other periodical source from articles in journals, newspapers and magazines used thereafter, are all meticulously
listed within the ebook itself. The journals are from various fields such as paleoanthropology, molecular genetics, human evolution, cellular genetics, biology
and biochemistry and more than 35 research articles from journals are cited within this scientific ebook.
I used both PubMed Central database (free Medline database) and Google Scholar database
when I needed to search for specific articles in journals. OCLC's WorldCat database allowed me to search for which libraries all over Britain had
the books I needed to
consult for this eBook. Aside from my main research work since 2004 at the British Library (a second home to me),
for several books I had to travel to public and university libraries in London, Manchester, Oxford, Cambridge, Milton Keynes
(Open University library) and the Library of Birmingham.
Chronological Sources: Books on Palaeoanthropology and Molecular Genetics
A list of every single source (except journals, magazines and newspapers) listed in the ebook, which I consulted (rented from Amazon or borrowed from university libraries or part of my personal collection of evolution books), arranged in chronological order. E.g. the first books in the list of chronological sources below were consulted first, those in the middle were used for the ebook midway, while those listed last were used last.
Evolution by Stephen Baxter, published in 2004 by Del Re. ISBN-13: 978-0345457837
The Ancestor's Tale: A Pilgrimage to the Dawn of Life by Richard Dawkins, published in 2005 by Mariner Books. ISBN-13: 978-0618619160
What on Earth Happened? in Brief: The Planet, Life and People from the Big Bang to the Present Day by Christopher Lloyd, published in 2009, by Bloomsbury Publishing PLC. ISBN-13: 978-1408802168
The Beginning of the Age of Mammals by Kenneth D. Rose, published in 2006 by Johns Hopkins University Press. ISBN-13: 978-0801884726.
The Greatest Show on Earth: The Evidence for Evolution by Richard Dawkins, published in 2010 by Black swan. 978-0552775243.
Dinosaur Heresies: New Theories Unlocking the Mystery of the Dinosaurs and Their Extinction by Robert Bakker, published in 1986 by Zebra Publishing .
Dinosauria by David B Weishampel, published in 2007 by University of California Press. ISBN-13: 978-0520254084.
Great Extinctions of the Past by Randi Mehling, published 2007 by Chealsea House. ISBN-13
9780791090497.
After the Dinosaurs: The Age of Mammals by Donald R. Prothero, published in 2006 by Indiana University Press. ISBN-13: 978-0253347336.
Your Inner Fish: The Amazing Discovery of our 375-million-year-old Ancestor by Neil Shubin, ISBN-13: 978-0307277459, published b Penguin in 2009.
The Cambrian Explosion: The Construction of Animal Biodiversity by Douglas Erwin and James Valentine. Published in 2013 by Roberts and Company. ISBN-13: 978-1936221035,
The Origin Of Humankind by Richard Leakey. Published in 1996. ISBN-13: 978-0465053131.
Introduction to Physical Anthropology by Robert Jurmain, Lynn Kilgore,
Wenda Trevathen and Russell L Ciochon, published by Cengage Learning in 2013. ISBN-13: 978-1285062051.
Primate Origins and Evolution: A Phylogenetic Reconstruction by Robert D Martin. Published by Princeton University, New Jersey and Springer, 1990, ISBN-13: 978-9401068536.
Evolution: The Human Story by Alice Roberts, published in 2011 by Dorling Kindersley, ISBN-13: 978-1405361651.
Our Origins: Discovering Physical Anthropology by Clark Spencer Larsen, published by W. W. Norton & Company in 2011. ISBN-13: 978-0393934984.
The Human Story: Where We Come from & How We Evolved by Chris B. Stringer, published by Sterling in 2008. ISBN-13: 978-1402757471.
The Story of the Human Body: Evolution, Health, and Disease by Daniel E. Lieberman, published by Vintage in 2014. ISBN-13: 978-0307741806.
The Origin of Our Species by Chris B. Stringer, published in 2012, by Allen Lane. ISBN-13: 978-0141037202. N.B. This book is the British equivalent of
Lone Survivors: How We Came to Be the Only Humans On Earth.
Primate Evolution and Human Origins edited by John G. Fleagle, published by Aldine Transaction, 1988. ISBN-13: 978-0202011752.
The Hunt for the Dawn Monkey: Unearthing the Origins of Monkeys, Apes, and Humans by Chris Beard, published in 2006 by University of California, Press, ISBN-13: 978-0520249868.
The Link: Uncovering our Earliest Ancestor by Colin Tudge et al published in 2009 by Little Brown and Company. ISBN-13: 978-0316070089.
Not a Chimp: The Hunt to Find Genes that Make US Human by Jeremy Taylor, published in 2009
by Oxford University Press. ISBN-13: 978-0199227785.
Almost Chimpanzee:
Redrawing the Lines That Separate Us from Them by John Cohen. Published in 2010 by Times Books. ISBN-13:
What It Means to be 98% Chimpanzee: Apes, Peoples and the Genes by Jonathan Marks, published in 2003 by University of California Press, ISBN-13: 978-0520240643.
Last Ape Standing: The Seven-Million-Year Story of How and Why We Survived by
Chip Walter. Published by Bloomsbury in 2014. ISBN-13: 978-1620405215.
The Human Story: Where We Come From and How We Evolved by
Charles Lockwood. Published in 2014 by Natural History Museum. ISBN-13: 978-0565093228.
The First Africans: African Archaeology from the Earliest Toolmakers to Most Recent Foragers (Cambridge World Archaeology) by Lawrence Barham and Peter Mitchell. Published by
Cambridge University Press in 2008. ISBN-13 978-0521612654
Sapiens: A Brief History of Humankind by Yuval Noah Harari. Published by Harper in 2015. ISBN-13: 978-0062316097
Principles of Human Evolution, by Roger Lewin and Robert A Foley, published in 2004 by Blackwell Publishing. ISBN-13: 978-0632047048.
The Origins of Modern Humans: Biology Reconsidered by Fred h Smith and James C M Ahern. Published in 2013 by
Wiley-Blackwell. ISBN-13: 978-0470894095
Lucy: The Beginnings of Humankind by Donald C. Johanson and Maitland Edey, published by Simon & Schuster in 1990. ISBN-13: 978-0671724993.
Lucy's Legacy: The Quest for Human Origins by Donald Johanson and Kate Wong, published in 2010 by Broadway Books. ISBN-13: 978-0307396402.
The First Human: The Race to Discover Our Earliest Ancestors by Ann Gibbons, published in
2007. ISBN-13: 978-1400076963.
Evolutionary History of the "Robust" Australopithecines edited by Frederick E. Grine, published by AldineTransaction, in 2008. ISBN-13: 978-0202361376.
Catching Fire: How Cooking Made Us Humanby Richard Wrangham, published in 2010. ISBB-13 978-1846682865.
Neanderthal Man: In Search of Lost Genomes by Svante Pääbo, published in 2016 by Audible Studios on Brilliance. ISBN-13: 978-1511320115
Cro-Magnon: How the Ice Age Gave Birth to the First Modern Humans by Brian Fagan, published in 2011 by Bloomsbury Press. ISBN-13: 978-1608194056.
Before the Dawn: Recovering the Lost History of Our Ancestors By Nicholas Wade,
published in 2006 by Penguin Press. ISBN-13 978-1429521123.
The Human Story , by Robin Dunbar. Published by Faber & Faber in 2005. ISBN-13: 978-0571223039.
Science & Human Origins , by Ann Gauger et al. Published by Discovery Institute Press in 2005. ISBN-13: 978-1936599042.
Born In Africa: The Quest for the Origins of Human Life , by Martin Meredith. Published by Simon & Schuster in 2011. ISBN-13: 978-1847372444.
Becoming Human: Our Past, Present and Future , published by Scientific American in 2013. ASIN: B00EWZC9NK (ebook only).
Humans: From the Beginning: From the First Apes to the First Cities, by Christopher Seddon. Published by Glanville Publications in 2014. ISBN-13: ISBN-13: 978-0992762049.
Human Evolution: A Pelican Introduction , by Robin Dunbar. Published by Scientific American in 2013. ISBN-13: 978-0141975313.
The Science of Human Origins by Claudio Tuniz, Giorgio Manzi, David Caramelli, published by Routledge in 2014. ISBN-13: 978-1611329728
Genes, Peoples and Languages by Luigi Luca Cavalli-Sforza, published in 2001 by
North Point Press. ISBN-13: 978-0865475298.
National Geographic Answer Book: Fast Facts About Our World by Kathryn Thornton published in 2010. ISBN-13: 978-1426203459.
Ancestors in Our Genome: The New Science of Human Evolution by Eugene E Harris, published in 2015 by Oxford University Press, ISBN-13: 978-0199978038.
The Deeper Genome: Why There is More to the Human genome Than Meets the Eye by John Parrington, published in 2015 by Oxford University Press, ISBN-13: 978-0199688739.
Biocode: The New Age of Genomics by Dawn Field and Neil Davies, published Oxford University Press in 2015. ISBN-13: 978-0199687756
in 2010. ISBN-13: 978-1426203459.
How Humans Evolved by Robert Boyd and Joan Silk. Published by Norton in 2009, ISBN-13: 978-0393936773.
History and Geography of Human Genes by Luigi Luca Cavalli-Sforza, published in 1994
by Princeton University Press. ISBN-13: 978-0691029054
Biochemistry For Dummies by John T Mooore. Published by John Wiley & Sons in 2008, ISBN-13 9780470194287.
Biochemistry by Lubert Stryer, et al published in 2010 by W. H. Freeman. ISBN-13: 978-1429229364.
Mapping Human History: Discovering Our Past Through Our Genes by Steve Olson,
published in 2002. ISBN-13: 004-6442091572.
The Human Story by Charles Lookwood. Published by Natural History Museum in 2007, ISBN-13: 9978-0565093228.
The History of the World by Andrew Marr. Published by Pan / BBC in 2013, ISBN-13: 978-1447236825.
The Seven Daughters of Eve by Bryan Sykes. Published by Corgi in 2001, ISBN-13: 978-0552152181.
The Real Eve: Modern Man's Journey Out of Africa by Stephen Oppenheimer. Published by Carroll & Graf Publisher in 2004, ISBN-13: 978-0786713349
The Human Lineage by Mat Cartmill and Fred H Smith. Published by Wiley-Blackwell in 2009, ISBN-13: 978-0471214915.
Genetics: From Genes to Genomes by Leland Hartwell et al. Published in 2010 by
McGraw-Hill. ISBN-13: 978-0073525266.
Revisiting Race in a Genomic Age (Studies in Medical Anthropology) by Barbara Koenig. published by
Rutgers University Press in 2008. ISBN-13: 978-0813543246.
Genomes, Evolution and Culture by Rene J. Herrera, Ralph Garcia-Bertrand and Francisco M. Salzano. Published by
Wiley-Blackwell in 2016. ISBN-13: 978-1-118-87640-4.
Human Molecular Genetics by Tom Strachan and Andrew Read. Published in 2010 by
Garland Science. ISBN-13: 978-0815341499.
Human Evolution: A Brief Insight by Bernard Wood. Published by Sterling in 2011.
Human Mitochondrial DNA and the Evolution of Homo sapiens
by Hans-Jurgen Bandelt, Dr. Vincent Macaulay and Dr. Martin Richards (eds). Published in 2006.
ISBN-13: 978-3-540-317883.
Genome: The Autobiography of A Species in 23 Chapters
by Matt Ridley. Published in 1999 by HarperCollins
ISBN-10: 0060194979
Human Evolutionary Genetics by Mark Jobling, Edward Hollox et al. Published in 2013 by
Garland Science. ISBN-13: 978-0815341482.
Molecular Biology: Principles of Genome Function by Nancy Craig et al. Published in 2014 by
Oxford University Press. ISBN-13: 978-0815341499.
Bound Together: How Traders, Preachers, Adventurers, and Warriors Shaped Globalization.
by Nayan Chanda. Published in 2008 by Yale University Press, ISBN-13: 9780300136234.
First Migrants: Ancient Migration in Global Perspective.
by Peter Bellwood. Published in 2013 by Wiley-Blackwell, ISBN-13: 978-1405189088.
Dawn Over the Kalahari : How Humans Became Human by Lasse Berg
published/translated into English in 2011, ISBN-13: 978-9186528102.
The Real Eve: Modern Man's Journey Out of Africa by Stephen Oppenheimer. Published in 2003 by
Carroll & Graf, ISBN-13: 978-08757476342
The Incredible Unlikeliness of Being: Evolution and the Making of Us
by Alice Roberts. Published in 2015 by Heron Books. ISBN-13: 978-1848664791.
Biological Anthropology: The Greatest Journey by James Shreeve. Published in 2006 by National Geographic Learning Reader. ISBN-13:
A Troublesome Inheritance: Genes, Race and Human History by Nicholas Wade. 2014. ISBN-13:
What's in Your Genes? Katie McKissick. 2014. ISBN-13:
Living Color: The Biological and Social Meaning of Skin Color
by Nina G. Jablonski, published in 2012, by University of California Press. ISBN-13:
Genes, Peoples and Languages by Luigi Luca Cavalli-Sforza, published in 2001 by North Point Press. ISBN-13: 978-0865475298
History and Geography of Human Genes by Luigi Luca Cavalli-Sforza, published in 2006 by Princeton University Press. ISBN-13: 978-0691029054
Genealogy Online For Dummies by Matthew Helm, published in 1998 by John Wiley & Sons. ISBN-13: 978-0470916513.
Who Do You Think You Are? Encyclopedia of Genealogy: The Definitive Reference Guide to Tracing Your Family History
by Nick Barratt et al, published in 2008 by Harper. ISBN-13:978-0007261994.
Britain Begins by Barry Cunliffe, published in 2014 by Oxford University Press. ISBN-13: 978-0199679454.
Ancestral Journeys: The Peopling of Europe from the First Venturers to the Vikings by Jean Manco, published in 2011 by Thames and Hudson. ISBN-13: 978-0500051788.
A History of Ancient Britain by Neil Oliver, published in 2012 by Weidenfeld & Nicolson. ISBN-13: 978-0297863328
Homo Britannicus: The Incredible Story of Human Life in Britain by Chris B. Stringer, published in 2007 by Penguin Books. ISBN-13: 978-0141018133
Britain: One Million Years of the Human Story by Chris B. Stringer and Rob Dinnis, published in 2014 by Natural History Museum. ISBN-13: 978-0565093372
Life in Britain after the Ice Age (Archaeology for All) by Star Carr, published in 2014 by NCouncil for British Archaeology. ISBN-13: 978-1902771991
The Origins of the British: A Genetic Detective by Stephen Oppenheimer published in 2007 by Robinson Publishing. ISBN-13: 978-1845294823
Blood of the Isles by Dr Bryan Sykes Publisher: Corg in 2007. ISBN-13: 978-1407400228.
This book is published as Saxons, Vikings and Celts: The Genetic Roots of Britain and Ireland in the United States and Canada.
After Ice: A Global Human History 20,000-5000 BC by Steven Mithen, published in 2004 by Phoenix. ISBN-13: 978-0753813928
The Story of Maths by Marcus du Sautoy , BBC DVD. B001M48UTG. 2008.
A Curious History of Mathematics by Joel Levy, published in 2013 by Andre Deutsch. ISBN-13: 978-0233004877
Guns, Germs and Steel: A Short History of Everybody for the Last 13,000 Years by Jared Diamond, published in 1998 by Vintage. ISBN-13: 978-0099302780
A History of World Agriculture : From the Neolithic Age to Current Crisis by Marcel Mazoyer and Laurence Roudart, published in 2006 by Routledge. ISBN-13: 978-1844073993
Timeline of World History by Gordon Kerr, published in 2011.
The 10,000 Year Explosion: How Civilization Accelerated Human Evolution by Gregory Cochran and Henry Harpending.
History and Geography of Human Genes by Luigi Luca Cavalli-Sforza, published in 2006 by Princeton University Press. ISBN-13: 978-0691029054.
Library World Records by Godfrey Oswald, published 2009 in the U.S. by McFarland & Co publishers. ISBN-13: 978-0786438525.
Ongoing Research today on Origins and Evolution of Mankind
Today research into the origins and evolution of mankind is still ongoing in the anthropology or biology departments of universities worldwide as well as independent research centres.
Most notable of the research centres in Europe are Human Origins Research Group at the Natural History Museum in London, U.K.;
Max Planck Institute For Evolutionary Anthropology in Leipzig, Germany and the Leverhulme Centre for Human Evolutionary Studies in Cambridge, U.K.
The Leakey Foundation in the U.S. funds young anthropologists and encourages public understanding
of human evolution.
Link to the Leakey Foundation in San Francisco.
Link to the Max Planck Institute For Evolutionary Anthropology in Germany.
Link to the Human Origins Research Group at the Natural History Museum in London.
Link to the Leverhulme Centre for Human Evolutionary Studies in Cambridge.
There are so many websites and twittwer accounts about human evolution or human orifins. My current favourtites are given below.
Three Major Websites on The Origins and Evolution of Mankind
Link to The Bradshaw Foundation.
Based in Geneva, Switzerland and privately-funded, the foundation provides an online learning resource.
Its main areas of focus are archaeology, anthropology and genetic research.
The Foundation carries out its work in collaboration with UNESCO, the Royal Geographic Society,
the National Geographic Society, the Rock Art Research Institute in South Africa and
the Trust for African Rock Art.
Link to the Smithsonian Institution look at Evolution. Based in Washington DC,
and funded by the U.S. government, it is the premier museum in the U.S.
Link to The Story of Human Evolution.
There are
so many videos on YouTube about Human Evolution.
This is one of the best. It is 1 hour 30 minutes long, so go get some drinks and popcorn before watching it.
NEW UPDATED DATA
Some Major Twitter sites on The Origins and Evolution of Mankind
@PaleoAnthropology+
@The Bradshaw Foundation
@The Leakey Foundation
@Sapiens
@Smithsonian Institution Human Origins
@Institute of Human Origins
@Palaeoanthropologist Clive Finlayson Author of the book Humans Who Went Extinct: Why Neanderthals died out and we survived
@Palaeoanthropologist Paige Madison
@African Fossils
@Origin Stories
@Palaeoanthropologist Lee Berger
@Palaeoanthropologist John Hawks
@Palaeoanthropologist Chris Stringer
@This View of Life
@Palaeoanthropologist Ann Gibbons
@LTU Palaeoscience
If you enjoyed reading this ebook from start to finish, or have new or updated information to add, or discovered an error in the text, do drop me a line at:
e-mail:
infolibrary@yahoo.co.uk
RECOMMENDED READING OR FURTHER READING
There are a few books that make fascinating reading by tracing human history in great detail from the day the earth was formed as this ebook has attempted to do.
These books among others currently stand out as particularly outstanding and brilliant, if read thoroughly from scratch till the last page over the weekend:
Sapiens: A Brief History of Humankind by Yuval Noah Harari. Published by Harper in 2015. ISBN-13: 978-0062316097. Israeli academic Yuval Noah Harari does an incredible job explaining how humans evolved.
I was so impressed with this book, today I have both the printed version and the ebook version. Read this book first before the rest given below. Bill Gates also
recommended this enjoyable book several times on his Twitter feeds!!
A Brief History of Everyone Who Ever Lived: The Stories in Our Genes by Adam Rutherford. Published by Weidenfeld & Nicolson
in September 2016. ISBN-13: 0297609378. This is a recent popular science book (published in 2016) by a geneticist and with over 400 pages, it kind of mirrors many parts of my popular science evolution blog above,
especially Section E, F , G and H, where I use results from the 2003 Human Genome Project to talk about humans and genes. Mr Rutherford starts the marvelous story of humans
essentially from the time of the Neanderthals. So if you want a short refresher basic course on what took place before the Neanderthals arrived on the scene, read sections
B, C and D of this evolution blog. I am still reading the book carefully and will add a more detailed review once I finish the book.
Evolution by Stephen Baxter, published in 2003, ISBN-13: 978-0575074095. In Evolution, Stephen Baxter explores deep time to dramatise the story of Earth's evolving primates--from tiny shrew-like creatures dodging huge reptilian predators in the Cretaceous Period, to humans of the 21st century and beyond.
The Ancestor's Tale: A Pilgrimage to the Dawn of Life by Richard Dawkins, published in 2005, ISBN-13: 978-0753819968. In this book, Richard Dawkins takes us on a dramatic pilgrimage through 3 billion years of life on earth as he traces the ancestry of life.
What on Earth Happened?... in Brief: The Planet, Life and People from the Big Bang to the Present Day by Christopher Lloyd, published in 2009, ISBN-13: 978-1408802168. This book is an amazing and endlessly entertaining story of the planet, life, and people. Thoroughly enjoyable to read, page after page.
10,000 Year Explosion: How Civilization Accelerated Human Evolution by Gregory Cochran and Henry Harpending, published in 2011, ISBN-13:978-0465020423. This book explains how human evolution has continued since the invention of agriculture, and how it has affected the course of history.
The Origin of Our Species by Chris B. Stringer, published in 2012, ISBN-13: 978-0141037202.
This book combines anecdote and serious scholarship and whets your appetite with crisp explanation of
the latest science in the study of the first humans, It's inherently fascinating, it is the ultimate forensic
investigation in the search for where "WE" came from and how we got here in our evolution.
Finally from an academic point of view, two books among many others are in the "essential reading category." First up are the ever popular anthropology
text books by Professor Emeritus Robert Jurmain (San Jose State University, California, U.S.). 2013, saw a new 14th edition of one of them: the arrival of a brand new edition
of Introduction to Physical Anthropology by Robert Jurmain, Lynn Kilgore, Wenda Trevathen and Russell L Ciochon, published
by Cengage Learning in 2013. It is a runaway favourite among university students and lecturers worldwide, but expensive!! ISBN-13: 978-1285062051.
Since genetics now plays a very important role in the study of the evolution of mankind, one of the foremost "essential reading" texts
is Human Evolutionary Genetics by Mark Jobling, Edward Hollox et al.
The new 2nd edition was published in 2013 by Garland